2 7: 1 — 2/7 помогите решить пример

Содержание

Отделение хирургии №2 - Городская клиническая больница 7 Казань

Хирургическое отделение № 2 открыто в мае 1987 года. В то время наша больница называлась МСЧ предприятия «Оргсинтез». С самого начала работы отделение оказывало экстренную хирургическую помощь  трём районам города Казани: Ленинскому, Кировскому, Московскому, а с 1994 года четырём районам: Авиастроительному, Ново-Савиновскому, Московскому, Кировскому. Отделение является базой кафедры хирургии Казанской Государственной Медицинской Академии, возглавляемой до 1993 года профессором Кочневым Олегом Сергеевичем, с 1993 года по 2008 год доцентом Шаймардановым Равилом Шамиловичем. С 2008 года по настоящее время кафедру возглавляет профессор Малков Игорь Сергеевич. Основным научным направлением клиники является изучение и разработка новых способов диагностики и лечения хирургических заболеваний, травм органов панкреатобилиарной системы, желудка, двенадцатипёрстной кишки.

Заведующий отделением хирургии №2 является Халилов Халил Магомедгаджиевич, родился 5 октября 1955 года; хирург высшей квалификационной категории, имеет ученую степень – кандидат медицинских наук, является заслуженным врачом РТ.

Заведует отделением хирургии №2 ГКБ №7 с 19 октября 1991 года по настоящее время.

Врачи отделения под руководством сотрудников кафедры активно занимаются научными исследованиями. С 1987 года врачами отделения хирургии № 2 были защищены 7 диссертаций на соискание ученой степени кандидата медицинских наук и 1 диссертация на ученую степень доктора медицинских наук. Совместно с сотрудниками кафедры, врачами отделения напечатаны более 100 научных статей, учебных пособий, монографий на тему перитонитов, ущемленных грыж, острого холецистита, механической желтухи, перфоративной язвы, гнойных ран и так далее.

В настоящее время в отделении хирургии №2 работают четыре врача с учёной степенью кандидата медицинских наук. Из 17 врачей отделения 10 имеют высшую, 3 первую и 1 вторую квалификационные категории.

Washer, 2,7 x 5 x 1, Plastic PA, 100 Pieces

Поставщики в вашем регионе

Ниже приведен список местных поставщиков, которые в настоящее время имеют этот товар на складе:

ДистрибьюторКоличествоДата наличия на складеЦена
Информация отсутствует.

ДОПОЛНИТЕЛЬНЫЕ СВЕДЕНИЯ ОБ ИЗДЕЛИИ

Шайба используется для фиксации печатной платы.

Количество, необходимое для сменных блоков IEEE (3U/6U)

Количество, необходимое для вставных модулей типа 2 с ручкой для извлечения (3U/6U)

Комплектность поставки

В комплект поставки этого изделия входят следующие позиции:

ИзделиеОписаниеКоличество
1 Шайба (2,7 x 5 x 1), пластиковый PA 100

Библия онлайн, Синодальный перевод == БИБЛИЯ-ЦЕНТР

 

Что такое человек? И что такое Эдемский сад? На первый взгляд может показаться, что речь идёт о совершенно реальной, земной географии. Однако такая священная география есть у всех народов. У всякого народа есть своя священная... 

 

Что такое человек? И что такое Эдемский сад? На первый взгляд может показаться, что речь идёт о совершенно реальной, земной географии. Однако такая священная география есть у всех народов. У всякого народа есть своя священная земля, своя мифологическая прародина — обычно там, где у народа проснулась историческая память, где для него началась его собственная история. Евреи помнят себя со времён Авраама — а значит Харрана, Северной Месопотамии, где и находится Эдемский сад. Было и ещё кое-что: память о временах, которые греки называли «золотым веком», когда человек жил в полной гармонии с миром, с другими людьми и с богами, и сам с собой тоже.

Эдемский сад Книги Бытия соединяет в себе черты мифологической прародины еврейства с описанием мира во времена «золотого века» — так священнописатель хочет нам сказать, что эти времена не просто миф, что когда-то человек действительно жил в полной гармонии с Богом, с миром, с самим собой и с другими людьми. Каким же был совершенный человек? В Поэме творения о нём говорится, что он — единственный из всех сотворённых Богом в нашем мире живых существ — был создан по образу и подобию Божию.

Все животные созданы каждое соответственно своему «роду» — или, как сказали бы мы сегодня, соответственно своему прототипу. И только у человека прототипа нет: каждый человек творится по образу Божию, и Бог Сам становится для человека «прототипом». Как же такое возможно? С точки зрения своей природы человек не отличается от других живых существ, он сотворён Богом из «земной пыли», а из мельчайших пылинок, как думали в те времена, когда был написан рассказ о сотворении человека, состоит и вся вселенная.

В человеческой природе как таковой ничего уникального нет. Уникальность человека в другом: в том «дыхании жизни», благодаря которому он становится «душой живой». В Библии «душа» — не статичная структура, а процесс, тот поток жизни, в котором присутствует и духовная, и природная составляющая — тут и высокие духовные движения, и простая физиология, вроде, к примеру, дыхания или кровообращения.

Современный философ, вероятно, назвал бы этот поток экзистенцией. Такова душа человека в библейском смысле слова. А существует поток человеческой жизни в том качестве, в каком существует, благодаря тому самому «дыханию жизни» — Божьему дыханию, Божьему присутствию в самом центре нашей собственной личности, которое и делает возможной самое её существование.

Не было бы Божьего «дыхания жизни» — не было бы и человека как образа Божьего, а был бы просто ещё один вид приматов. Потому-то и нет человека без непрерывного богообщения — дыхание ведь не одномоментный акт, а процесс, который должен продолжаться непрерывно. Человек был задуман и создан Богом для непрерывного богообщения, вне которого он в духовном смысле просто не может оставаться собой. И всё же Бог оставляет человеку свободу: он может жить так, как предлагает ему Бог, или избрать свой собственный вариант существования — под свою полную ответственность за все последствия своего выбора.

Поликлиника №2 (ул.

Солнечная, 31) | Кировская клиническая больница №7
№ участкаТерритория обслуживания
14

 

Семенченко Елизавета АлександровнаПр Строителей 15, 19/1, 19/2,42, 42/1, 42/2

Ул. Воровского 110, 112

Ул.М. Конева 5/1,

Ул. Ульяновская  21/1, 21/2

15Мыльникова Ольга ЛеонидовнаСолнечная 39, 45, 55

Ул. Инженерная, пер. Инженерный

Ул. Пархоменко,

Ул. Фрунзе, пер Фрунзе

Ул. Энтузиастов 4

Ул. Ульяновская 30, 34, 36

16

 

Чипсанова Татьяна НиколаевнаУл. Волкова 3, 3/1, 3/2,5/1, 5/2

Пр. Строителей 46, М.Конева  7/5,7/7

17

 

Бухарова Елена Николаевна Ул. Юровской 1

Ул. М.Конева 13

Ул. Волкова 2, 4 Ул. Солнечная 29

18

 

Ехало Наталья Васильевна Ул. Солнечная 31, 31/1
19

 

Лушкова Татьяна АнатольевнаУл. Энтузиастов 1, 3, 5

Ул. Ульяновская 22, 22/1, 24

Ул. Солнечная  37

Ул. Юровской 6,8

20

 

Земакеева Анна СергеевнаПр Строителей 50, 54, 52,23

Ул. Волкова 12   Ул. Юровской 7, 9

21

 

Макарова Татьяна СергеевнаУл. Воровского 104, 106, 108,

Ул. М.Конева 5, ул. М.Конева 7/1, 7/2, 7/6

22

 

Козлов Станислав Сергеевич
Ул. Волкова 1

Ул. М. Конева 7, 7/3, 7/4, 9

23

 

Сконцей Наталья АлексеевнаУл. Волкова 5, 8, 10, 10/1

Пр. Строителей 50/1, 50/2, 50/3

Ул. Солнечная 31/3

24

 

Ехало Н.В.

 

 

Ул. Солнечная 31/2

Ул. Конева 13/1, 13/2

Ул. Волкова 2/1

Ул. Юровской 2

25

 

Кокина Екатерина АлександровнаУл. Юровской 2а, 3, 4, 5,11

Ул. Егоровская  2,3,4,6,

Ул. Солнечная 35, 35а

26

 

Селюнина Анна Юрьевна

 

Ул. Солнечная 100

Ул. Ульяновская 1, 3, 5, 7, 9, 11,13,15

Ул. Курская, Пер. Курский 1, 2, 3

Д. Шики , Д. Фадино , Ул. Рудная,

ул. Архитектора Валерия Зянкина вся:10,10/1,10/2,7,7/1,7/2,7/3,7/4,11,11/1,9,9/1,13,13/1, 12

27

 

Краева Ирина Владимировна

 

Пр Строителей  17, 17/1

Ул. Ульяновская 20, 20/1, 20/2,

Ул. Воровского 118, 120, 120/1

  28Дреко Дарья Сергеевна

 

Ул. Капитана Дорофеева 3,5, 26,

ул. А.Михеева д.20, 20а

ул. Капитана Плетнева,

Ул.Энтузиастов   д.11,15,15/1,15/2,19,19а,20,23а

ул Радостная д.1,3,4,5,6,

ул. Щорса 129,127,125

ул. Вдохновения д.1,3,9

садоводческие товарищества «Лепсе», «Полянка», «Мичуринец», «Светлана», «Фадино»

2-7 трипл дро (2-7 Triple Draw). Правила игры

Одной из самых интересных игр с обменом является 2-7 Трипл Дро. Научиться играть в покер Трипл Дро совсем несложно. Эта игра считается технически очень сложной и дисперсионной, а также относится к числу популярных видов покера. Не зря в 2013 году именно на столах Трипл Дро происходили основные баталии регуляров заоблачных лимитов.

Правила 2-7 Трипл Дро

Игра является лимитной и проходит с блайндами и баттоном. Каждый получает по пять закрытых карт, после чего происходит круг торговли, который начинается с игрока, сидящего слева от большого блайнда. Ход переходит по часовой стрелке, каждый игрок может отправить карты в пас, сделать рейз или колл. По завершению торгов начинается первый раунд обмена, который начинает игрок, сидящий слева от баттона. Обменять можно до пяти карт.

Всего в игре предусмотрено три раунда, на каждом происходит торговля и обмен карт. По завершению последнего круга происходит вскрытие, если в этом есть необходимость.

 

 

 Определение победителя в Трипл Дро

Трипл Дро относится к разновидности Лоуболла. Это означает, что на вскрытии выигрывает обладатель слабейшей руки. Однако в Трипл Дро определение лоу-комбинации существенно отличается от остальных игр. Важно помнить, что туз всегда считается старшей картой, а стрит и флеш учитываются при определении комбинации. Поэтому с «колесом» можно в покер онлайн играть бесплатно разве что блефом, а сильнейшей комбинацией в Трипл Дро является не одномастная рука 23457.

Можно сказать, что чем слабее ваша комбинация была бы в Холдеме, тем сильнее она в Трипл Дро.

Примечание: Если в колоде не осталось карт для обеспечения обмена, то уже сброшенные игроками  карты замешиваются и раздаются вновь. Следует помнить, что чаще всего игроки сбрасывают высокие карты, потому в случае замешивания от обменов стоит воздержаться.  

Немного о стратегии игры

Играя в Трипл Дро, вам следует исключить из своего арсенала руки, которые могут потребовать более двух обменов для составления сильной комбинации.

  • Натсовые руки

Если вам раздали 7 или 8 хай, то следует агрессивно разыгрывать ее перед первым обменом, так как отказ от обмена на первом же раунде торгов сделает вашу руку фейс-ап (очевидной), и оплаты своих ставок вы можете больше не получить. Слоуплеить смысла нет.

Четыре невысоких карты считаются сильными стартовыми руками в Трипл Дро, и разыгрывать их стоит максимально агрессивно. Однако нужно остерегаться стрит-дро рук, например, для руки x4567 аутами на усиление руки могут быть лишь двойки и девятки.  

Необходимо отметить, что если в раздаче образовался мультипот, то ваши шансы купить двойку или тройку существенно понижаются, так как вероятнее всего низкие карты уже были розданы другим игрокам.

В отличие от большинства лимитных игр, блеф в Трипл Дро является очень важной составляющей игры, так как многие раздачи не доходят до шоудауна. Например, если игрок обменял более одной карты, то вероятность покупки сильной руки очень невысока  и стоит рассмотреть отказ от обмена и ставку в блеф. В целом очень важно внимательно следить за обменами соперников и четко представлять впечатления, которые производят ваши действия на оппонентов. 

 В следующей статье вы сможете ознакомится правилами Пай Гоу покера. 

 

2 Thessalonians 2: 7 Ибо тайна беззакония уже действует; но тот, кто теперь сдерживает ее, будет продолжаться, пока не будет убран с дороги.

(7) For. - Логично, что «for» относится к предложению «тот, кто дает»; таким образом: «Ибо, хотя тайна уже действует, лукавый не откроется, пока тот, кто ныне удерживает, не исчезнет».

Тайна беззакония уже действует. - И «тайна», и «беззаконие» имеют артикль на греческом языке, возможно (как во 2 Фессалоникийцам 2: 3), потому что это выражение было хорошо известно фессалоникийцам.Беззаконие является более буквальным переводом, чем «беззаконие»; то же слово в 1 Иоанна 3: 4 переведено как «нарушение закона». Слово «тайна» по-гречески не обязательно подразумевает какое-либо понятие таинственности в нашем современном понимании. Это означает секрет (который по своей природе может быть довольно простым), известный посвященным, но не подлежащий раскрытию до тех пор, пока он не будет раскрыт. Здесь весь акцент делается на слове «тайна» из-за весьма своеобразного порядка расположения греческих слов. Его можно перефразировать так: «Ибо как тайна, в которую мир еще не посвящен, это беззаконие уже действует.«Таким образом, слово« тайна »резко контрастирует со словом« явлено »во 2 Фессалоникийцам 2: 6; 2 Фессалоникийцам 2: 8: время для публикации, открыто признавая, что секрет еще не пришел. Тайна этого беззакония теперь известна? Не всем тем, кто способствует его окончательному проявлению, потому что большинство из них обмануты им (2 Фессалоникийцам 2:10) и, хотя и участвуют в Отступничестве, все еще считают себя членами Церкви. Тайна известна Богу, и (1) просвещенным христианам, таким как св.Павел; (2) Сатане и нескольким сатанинским мужчинам, которые заявляют себе о своей реальной цели присоединения к движению. Хотя считается, что тайна действует (глагол выражает внутреннюю деятельность, например, 1 Фессалоникийцам 2:13, Римлянам 7: 5, как у закваски на тесте), это не личное дело (например, «Человек греха» , "" то, что утаивает ") скрытое описание любого лица или группы лиц; это исключительно непризнанный замысел, который постепенно приобретает влияние в человеческих сердцах: это то же самое движение, что и «отпадение» 2 Фессалоникийцам 2: 3.В нескольких местах (например, 2 Петра 2: 1 и след .; Иуды 1:18 и след.) Говорится о более грубой стороне «отпадения», но здесь «беззаконие», похоже, не столько означает обычный антиномизм, сколько неподчинение Богу - бунт. . . .

Стих 7. - За тайной. «Тайна» здесь означает нечто, что было неизвестно или тайно до того, как было открыто (ср. Ефесянам 3: 3-5). Точно так же одно из имен Вавилона, вместилища антихристианской власти, - Тайна (Откровение 17: 3). Беззакония; скорее, беззакония; а именно это отступничество, которое предшествует пришествию человека греха. Родительный падеж здесь - это аппозиция - «та тайна, которая есть беззаконие», сущность и сфера действия которой - беззаконие. Уже работает; или уже работает. Тайна беззакония даже сейчас действует втайне; но сам человек греха не появится, пока сдерживающая сила не будет снята. Даже в то время, когда апостол писал, семена отступничества уже были посеяны; закваска беззакония бродила внутри христианства; закладывались основы ложного христианства.Таким образом апостол предупреждал ефесян, что лжеучители возникнут из их среды; Тимофею он пишет о тех тяжелых временах, которые тогда были; и в его Посланиях упоминаются ложные обычаи и доктрины, такие как поклонение ангелам, воздержание от мяса, телесные умерщвления и честь, возложенная на безбрачие. Так и Иоанн в своем Первом Послании упоминает об этом действии этой антихристианской силы, когда говорит: «Дети, это последний раз; и, поскольку вы слышали, что придет антихрист, даже сейчас есть много антихристов.... Всякий дух, не исповедующий, что Иисус Христос пришел во плоти, не от Бога: это тот дух антихриста, о котором вы слышали, что он придет; и даже сейчас он уже есть в мире »(1 Иоанна 2:18; 1 Иоанна 4: 3). « Антихрист не выходит на сцену внезапно без каких-либо приготовлений; напротив, поток антихристианских настроений и поведения пронизывает всю историю мира »(Ольсхаузен). Только тот, кто сейчас дает, или, сдерживая старое значение слова« пусть.«Позволит». Этих слов нет в оригинале, и их следует опустить. Пока он не будет убран с дороги. Все предложение должно быть переведено так: «Тайна беззакония уже действует, только до тех пор, пока сдерживающий не станет удалено; "когда это произойдет, когда сдерживающее влияние будет устранено, тайна беззакония больше не будет действовать тайно, но будет открыто проявляться. Параллельные комментарии ...

Греческий

Для
γὰρ (gar)
Conjunction
1063 Стронга" : For. Первичная частица; собственно, с указанием причины.

the
τὸ (to)
Article - именительный падеж Единственного числа
Strong's 3588: The, определенный артикль. Включая женский род he и средний род to во всех их перегибах; Определенный артикль; файл.

тайна
μυστήριον (mystērion)
Существительное - именительный падеж Единственного числа
3466 Стронга: От производного от muo; секрет или «тайна».

беззакония
ἀνομίας (anomias)
Существительное - родительный падеж женский род единственного числа
Стронг 458: беззаконие, беззаконие, непослушание, грех.От аномоса; противозаконность, т.е. нарушение закона или злодеяние.

{is} уже
ἤδη (ēdē)
Наречие
Strong's 2235: Уже; теперь наконец, теперь после всего этого ожидания. Видимо из е и де; даже сейчас.

на работе,
ἐνεργεῖται (energeitai)
Глагол - Настоящее Изобразительное Средство - 3-е лицо Единственного числа
Стронг 1754: От энергии; быть активным, эффективным.

но
μόνον (монон)
Наречие
3440 Стронга: Один, но только. Средний от моноса как наречия; просто.

[тот, кто]
ὁ (ho)
Артикул - именительный падеж Единственного числа
Стронг 3588: Определенный артикль. Включая женский род he и средний род to во всех их перегибах; Определенный артикль; файл.

сейчас
ἄρτι (arti)
Наречие
Стронг 737: Сейчас, только сейчас, в этот момент. Наречие от производного от airo через идею приостановки; прямо сейчас.

сдерживает [it]
κατέχων (katechōn)
Глагол - настоящее причастие активное - именительный падеж единственного числа
Стронг 2722: от ката и эха; удерживать, в различных приложениях.

[будет продолжаться] до
ἕως (heōs)
Conjunction
Strong's 2193: союз, предлог и наречие продолжения, до.

он взят
γένηται (genētai)
Глагол - сослагательное наклонение Aorist Среднее - 3-е лицо единственного числа
Strong's 1096: форма продолжения и среднего голоса основного глагола; заставлять быть, то есть становиться, использоваться с большой широтой.

из
ἐκ (ek)
Предлог
1537 Стронга: Изнутри, из среды, изнутри, изнутри наружу.Первичный предлог, обозначающий происхождение, от, от.

[путь].
μέσου (mesou)
Прилагательное - родительный падеж среднего рода Единственное число
Strong's 3319: Посередине, посередине, между, посредине. Из мета; средний (средний род) существительное).

Перейти к предыдущему

Уже продолжить Злые упражнения Удерживают Влияние Беззаконие Сохранение беззакония Тайна Сила удалена Сдерживает Сдерживает Сдерживает Сдерживает Секретный способ Работы

Перейти к следующему

Уже продолжать Злые упражнения Удерживает Влияние Влияние Тайное Беззаконие Сдерживает Сдерживание Беззаконие Сдерживает Сдержанность Сдерживает Сдержанность Работа Работает

Ссылки

2 Фессалоникийцам 2: 7 NIV
2 Фессалоникийцам 2: 7 NLT
2 Фессалоникийцам 2: 7 ESV
2 Фессалоникийцам 2: 7 NASB
2 Фессалоникийцам 2: 7 KJV2 Фессалоникийцам 2: 7 BibleApps.com
2 Фессалоникийцам 2: 7 Библия Паралела
2 Фессалоникийцам 2: 7 Китайская Библия
2 Фессалоникийцам 2: 7 Французская Библия
2 Фессалоникийцам 2: 7 Цитаты Кликса NT Letters: 2 Фессалоникийцам 2: 7 Ибо тайна беззакония уже действует (2 Фессалоникийцам . 2 Thes. 2Th iiTh ii th)

Подавление вспышки SARS-CoV-2 в итальянском муниципалитете Во

Место проведения исследования

Муниципалитет Во в провинции Падуя, регион Венето, Италия, находится в расположен примерно в 50 км к западу от Венеции (рис.1а). Согласно последним данным земельного кадастра, в Во 'проживает 3275 человек на площади 20,4 км. 2 . При обнаружении SARS-CoV-2 у умершего жителя Во '21 февраля 2020 года, в тот же день, когда в Во' был обнаружен первый случай COVID-19, и через 1 день после выявления первой местной инфекции COVID-19 в Италии мы провели эпидемиологическое исследование, чтобы изучить распространенность инфекции SARS-CoV-2 среди населения. Отбор проб проводился у большинства населения Vo 'в двух временных точках: первый в течение нескольких дней сразу после выявления первых случаев (21–29 февраля 2020 г.), а второй - в конце двухнедельного карантина. (7 марта 2020 г.) (рис.1в). Для каждого жителя мы собрали информацию о датах отбора проб, результатах тестирования на SARS-CoV-2, демографические данные (например, возраст и пол), место жительства, медицинскую карту (включая симптомы и даты госпитализации, связанные с COVID-19, предыдущие состояния. и лечение других заболеваний), размер домохозяйства и сеть контактов. Данные были сопоставлены с помощью Microsoft Excel, а электронная таблица наборов данных доступна по адресу https://github.com/ncov-ic/SEIR_Covid_Vo. Статистические методы не использовались для предварительного определения размера выборки.Эксперименты не были рандомизированы, и исследователи не были закрыты для распределения во время экспериментов и оценки результатов.

Симптоматический определяется следующим образом: участник, который нуждался в госпитализации и / или сообщил о лихорадке (да / нет или температура выше 37 ° C) и / или кашле и / или как минимум двух из следующих симптомов: боль в горле, головная боль, диарея, рвота, астения, мышечная боль, боль в суставах, потеря вкуса или запаха или одышка.

Лабораторные методы

Образцы верхних дыхательных путей были собраны медицинскими работниками с помощью одного конусообразного тампона, использованного для обработки ротоглотки, затем носовых средних носовых раковин, и сразу же помещены в стерильную пробирку, содержащую транспортную среду (eSwab, Copan Italia Spa). Отбор образцов проводился в соответствии с руководящими принципами 18 Центров США по контролю и профилактике заболеваний. Вкратце, для взятия пробы из ротоглотки мазок вводили в заднюю часть глотки и области миндалин и протирали обе столбы миндалин и заднюю часть ротоглотки, избегая касания языка, зубов и десен; для взятия пробы из носа тампон вводили в обе ноздри примерно на 2 см, осторожно вращая по стенке носа несколько раз. Образцы хранили при 2–8 ° C до тестирования, которое проводилось в течение 72 ч после сбора.В качестве меры правильного выполнения выборки каждая ПЦР содержит внутренний контроль, предназначенный для амплификации человеческого домашнего гена, кодирующего РНКазу P. Реакции, которые не показали внутреннего положительного контроля, были классифицированы как недействительные и повторялись. Общие нуклеиновые кислоты очищали из 200 мкл образцов мазков из носоглотки и элюировали в конечном объеме 100 мкл с использованием системы MagNA Pure 96 (Roche Applied Sciences). Обнаружение РНК SARS-CoV-2 выполняли с помощью собственного метода ОТ-ПЦР в реальном времени, который был разработан в соответствии с протоколом и праймерами и зондами, разработанными Corman et al. 19 , которые нацелены на гены, кодирующие конверт ( E ) (E_Sarbeco_F, E_Sarbeco_R и E_Sarbeco_P1) и РНК-зависимую РНК-полимеразу ( RdRp : RdRp_SARSr-F, RdRp_SARdrp-R_SARdrP_RdRp_SARdrSr_RdRp_SARdrSr_RdRp_SARdrSr_RdRp_SARdrSr-R_SARSRP_RDRP_SARDRP_ -CoV-2. Анализы ОТ-ПЦР в реальном времени выполняли в конечном объеме 25 мкл, содержащем 5 мкл очищенных нуклеиновых кислот, с использованием набора One Step Real Time (Thermo Fisher Scientific) и запускали на системах обнаружения быстрых последовательностей ABI 7900HT (Thermo Fisher Scientific) . Чувствительность анализов гена E и RdRp составила 5.0 и 50 эквивалентных копий генома на реакцию при вероятности обнаружения 95% соответственно. Оба анализа не показали перекрестной реактивности с эндемичными коронавирусами человека HCoV-229E, HCoV-NL63, HCoV-OC43 и HCoV-HKU1 и с MERS-CoV. Все тесты проводились в отделении клинической микробиологии и вирусологии университетской больницы Падуи, которое является региональной справочной лабораторией по новым вирусным инфекциям. После начального периода двойного тестирования Национальной справочной лабораторией Итальянского института здравоохранения (Istituto Superiore di Sanità), которое продемонстрировало 100% совпадение результатов, Региональная справочная лаборатория получила аккредитацию в качестве справочной лаборатории для тестирования COVID-19.

Оценка геномных эквивалентов

Порог цикла ( C t ) Данные анализов ОТ-ПЦР в реальном времени были собраны для генов E и RdRp . C t данные для гена E были доступны для 30 симптоматических, 5 предсимптомных и 23 бессимптомных инфекций, а для гена RdRp - для 27 симптоматических, 9 пресимптоматических и 26 бессимптомных инфекций. Эквивалентные копии генома на мл рассчитывали согласно линейной регрессии, выполненной на калибровочных стандартных кривых. Интерполированные значения C t были дополнительно умножены на 100 в соответствии с окончательным коэффициентом разбавления (1: 100). Линейная регрессия была рассчитана в Python3.7.3 с использованием модулей scipy 1.4.1, numpy 1.18.1 и matplotlib 3.2.1 20 . Эквивалентные геномные распределения двух генов для положительных симптоматических, бессимптомных и пресимптомных участников сравнивались с точным тестом Вилкоксона-Манна-Уитни. В наборе данных представлены как эквиваленты генома вирусной нагрузки, так и необработанные данные C t .

Реконструкция цепочек передачи

Мы использовали данные о контактах, отслеживаемых внутри сообщества, и о контактах в домохозяйствах, полученные из данных о составе домохозяйств (представленных в наборе данных), для условного расчета цепочек передачи и кластеров передачи. Мы использовали пакет R epicontacts 21,22 для визуализации реконструированных цепей передачи. В дополнительном информационном тексте 1 представлены алгоритмы, используемые для определения последовательного интервала (время от появления симптомов у инфектора до появления симптомов у инфицированного) и эффективного репродуктивного числа (среднее количество вторичных инфекций, вызванных идентифицированными инфекторами). и 2 соответственно.Вкратце, мы вывели дату появления симптомов для участников с положительным результатом теста, но с отсутствующей датой начала из наблюдаемых временных интервалов от появления симптома до подтверждения (для участников, которые дали положительный результат при нескольких выборках, мы использовали первую выборку. время). Затем мы использовали наблюдаемые и предполагаемые даты появления симптомов вместе с контактной информацией, чтобы сделать вывод о парах передачи в пределах выборки. В свою очередь, реконструированные пары передачи использовались для характеристики последовательного интервала в течение всего периода исследования, а также в периоды до и после блокировки.Оценки центрального эффективного числа воспроизводств были рассчитаны как среднее количество вторичных инфекций, вызванных наблюдаемыми или условно приписанными инфекторами, при стохастическом назначении возбудителя, когда было идентифицировано более одного или не было выявлено ни одного потенциального инфектора. 95% доверительный интервал оценивался методом начальной загрузки. Все подробности представлены в Дополнительных информационных текстах 1 и 2.

Математическое моделирование

Первое обследование проводилось между 21 и 29 февраля 2020 года, а второе обследование - 7 марта 2020 года.В модели мы предположили, что распространенность была взята на основе средневзвешенного значения даты первого сбора пробы, то есть 26 февраля 2020 г. и 7 марта 2020 г. Блок-схема модели представлена ​​на рис. 5 с расширенными данными. предположили, что популяция Vo 'была полностью восприимчивой к SARS-CoV-2 (S-компартмент) в начале эпидемии. После заражения инфицированные люди инкубируют вирус (E-компартмент) и имеют неопределяемую виремию в среднем в течение 1/ ν дней до перехода в стадию (TP-отсек), которая длится в среднем 1/ δ дней, в которой люди демонстрируют нет симптомов и обнаруживается виремия.Мы предполагаем, что часть p инфицированного населения остается бессимптомной на протяжении всего периода инфекции (отсек I A ), а у оставшейся части 1 - p развиваются симптомы ( I S отсек ). Мы предполагаем, что пациенты с симптомами ( I S ), бессимптомные ( I A + p TP) и пресимптомные ((1- p ) TP) люди способствуют дальнейшей передаче SARS-CoV- 2 и что люди с симптомами, бессимптомным и бессимптомным течением вируса передают вирус в среднем в течение 1/ δ + 1/ γ дней.Мы также предполагаем, что вирус может быть обнаружен с помощью мазка по истечении инфекционного периода; это предположение совместимо с гипотезой о том, что передача происходит при вирусной нагрузке выше определенного порога, но диагностический тест может обнаружить присутствие вируса ниже порога передачи. В отсеках TP S и TP A , соответственно, представлены люди с симптомами и бессимптомно, которые больше не заразны, но имеют обнаруживаемую вирусную нагрузку и, следовательно, положительный результат теста.{1} \) из-за вмешательства. Допустим, что T i обозначает количество участников, взятых при обследовании i ( i = 1, 2), и пусть P A i , P P i и P s i , соответственно, обозначают количество положительных мазков среди бессимптомных, пресимптомных (то есть тех, которые не проявляют никаких симптомов во время тестирования, но проявляют симптомы позже) и симптоматических участников, соответственно.Мы предполагаем, что количество положительных мазков среди симптоматических, предсимптомных и бессимптомных инфекций при обследовании i следует биномиальному распределению с параметрами T i и π Xi , где π20 Xi представляет собой вероятность положительного результата теста при опросе i для X (где X = A, P, S). Для симптоматических участников π S i определяется как \ ({\ pi} _ {{\ rm {S}} i} = \, \ frac {{I} _ {{\ rm {S}}) }} ({t} _ {i}) + {{\ rm {T}} {\ rm {P}}} _ {{\ rm {S}}} ({t} _ {i})} {N } \) для бессимптомных участников π A i определяется как \ ({\ pi} _ {{\ rm {A}} i} = \, \ frac {p {\ rm {T}) } {\ rm {P}} ({t} _ {i}) + {I} _ {{\ rm {A}}} ({t} _ {i}) + {{\ rm {T}} { \ rm {P}}} _ {{\ rm {A}}} ({t} _ {i})} {N} \), а для бессимптомных участников π P i определяется как \ ({\ pi} _ {{\ rm {P}} i} = \, \ frac {(1-p) {\ rm {T}} {\ rm {P}} ({t} _ {i} )} {N} \), предполагая совершенную диагностическую чувствительность и специфичность.Вероятность модели определяется как произведение биномиальных распределений для симптоматических, предсимптомных и бессимптомных участников временами t i , i = 1, 2. Вывод был проведен в байесовской структуре с использованием Метод Монте-Карло с цепью Маркова Метрополиса – Гастингса (MCMC) с однородными априорными распределениями 23 . Мы зафиксировали среднее время генерации (равное 1/ ν + 1/ δ + 1/ γ ) на 7 дней 19 и позволили модели вывести 1/ ν и 1/ δ .{1} \): 2.1, 2.4, 2.7, которые совместимы с временем удвоения в 3–4 дня, как это наблюдается в Во 'и других местах в регионе Венето. Мы предположили, что заражение произошло 4 февраля 2020 года. Мы изучили различные сценарии средней продолжительности обнаружения вируса за пределами инфекционного периода и зафиксировали 1/ σ равным 2, 4, 6, 8, 10 и 12 дням. Мы оцениваем количество инфекций, занесенных в население из других источников в момент времени t 0 (4 февраля 2020 г. {1} \) из-за вмешательств (1 - w ) 100%.

Анализ ассоциаций

Мы применили логистическую регрессию для проверки связи между положительностью SARS-CoV-2 (в целом и в первом и втором опросах отдельно) с возрастной группой (10 лет возрастные группы, от 0 до> 81 года). возраста) и пола (мужской и женский). Мы использовали точный тест Фишера для сравнения двух биномиальных пропорций, чтобы оценить, существует ли связь между наличием симптомов для 41 подтвержденного случая COVID-19, проживающего в Vo ’, и различными типами сопутствующих заболеваний и используемых методов лечения.Анализы были повторены на подгруппе пациентов, у которых во второй момент времени был отрицательный результат (результаты не показаны). Чтобы повысить достоверность данных, мы увеличили размер выборки, включив еще 11 подтвержденных случаев COVID-19, которые проживали в других деревнях недалеко от Во '. Ни один из этих сценариев не дал значимых ассоциаций на уровне 5%.

Заявление об этическом одобрении

Первая выборка населения Vo ’была проведена в рамках программы наблюдения, установленной в регионе Венето, и не требовала этического одобрения; второй отбор образцов был одобрен Комитетом по этике клинических исследований провинции Падуя.Участие в исследовании было по согласию. Для участников младше 18 лет согласие было предоставлено родителем или законным опекуном.

Краткое изложение отчета

Дополнительная информация о дизайне исследования доступна в Резюме отчета по исследованию природы, связанном с этим документом.

Версия Python 2.7.0 | Python.org

Примечание. В настоящее время доступен выпуск исправления ошибок 2.7.16. Рекомендуется его использование.

Python 2.7.0 был выпущен 3 июля 2010 г.

Python 2.7 должна стать последней основной версией в серии 2.x перед ней. переходит в расширенный период обслуживания. Этот выпуск содержит многие из функции, которые впервые были выпущены в Python 3.1. Улучшения в этом выпуске включают:

  • Упорядоченный тип словаря
  • Новые функции модульного тестирования, включая пропуск тестов, новые методы утверждения и тесты. открытие
  • Гораздо более быстрый модуль io
  • Автоматическая нумерация полей в методе str.format ()
  • Усовершенствования репродукции с плавающей запятой перенесены из 3.х
  • Поддержка плитки для Tkinter
  • Бэкпорт объекта memoryview из 3.x
  • Установить литералы
  • Множественные и словарные понятия
  • Просмотр словаря
  • Новый синтаксис для вложенных операторов с
  • Модуль sysconfig

Для получения дополнительной информации см. Эти ресурсы:

Это производственная версия. Пожалуйста, сообщайте обо всех обнаруженных вами ошибках.

В настоящее время мы поддерживаем следующие форматы для загрузки:

Архивы с исходным кодом подписаны ключом Бенджамина Петерсона (отпечаток: 12EF 3DC3 8047 DA38 2D18 A5B9 99CD EA9D A413 5B38).Установщик Windows был подписан открытым ключом Мартина фон Лёвиса, который имеет идентификатор ключа 7D9DC8D2. Mac установщики были подписаны ключом Рональда Уссорена, который имеет идентификатор ключа E6DF025C. Открытые ключи находятся на странице загрузки.

Контрольные суммы MD5 и размеры выпущенных файлов:

35f56b092ecf39a6bd59d64f142aae0f 14026384 Python-2.7.tgz
0e8c9ec32abf5b732bea7d91b38c3339 11735195 Python-2.7.tar.bz2
bd0dc174cbefbc37064ea81db1f669b7 16247296 python-2.7.amd64.msi
1719febcbc0e0af3a6d3a47ba5fbf851 15

2 python-2.7.msi 759077d3763134b3272f0e04ea082bd9 21420655 python-2.7-macosx10.3.dmg bb3d6f1e300da7fbc2730f1af9317d99 21509961 python-2.7-macosx10.5.dmg 575156d33dc71b6581865a374f5c7ad2 5754439 python27.chm

2 Поезд (7 Avenue Express) Схема маршрута

135 St

W 135 St and Lenox Ave

Две боковые площадки

3

Метро, ​​местная станция, ADA доступно

125 St

W 125 St and Lenox Ave

Две боковые площадки

3, SBS M60 до аэропорта

Метро, ​​местная станция

116 ул

W 116 St and Lenox Ave

Две боковые площадки

3

Метро, ​​местная станция

Central Park North (110 St)

W 111 St and Lenox Ave, St Nicholas Ave и Central Park North

Платформа с одним островом

3

Метро, ​​местная станция

96 St

Бродвей между W и 96 St., Бродвей и W 94 St

Две островные платформы

1,3

Метро, ​​местная и экспресс-станция, ADA доступно

72 ул

W 72 St между Бродвеем и Амстердамским проспектом

Две островные платформы

1,3

Метро, ​​местная и экспресс-станция, ADA доступно

Times Sq- 42 St

W 42 St и 7th Ave и Бродвей, W 40 St и 7th Ave

Две островные платформы

A, C все время, кроме поздней ночи, E, N, Q, R все время, кроме поздней ночи, W в будние дни, S все время, кроме поздней ночи, 1,3,7

Метро, ​​местная и экспресс-станция, доступ в ADA (кроме линий A, C, ES)

34 St- Penn Station

W 34 St и 7th Ave, W 33 St и 7th Ave, W 32 St и 7th Ave

Одна островная платформа, две боковые платформы

1,3 всегда, кроме поздней ночи

Метро, ​​местная и экспресс-станция, ADA доступно

14 ул

W 14 St и 7th Ave, W 13 St и 7th Ave, W 12 St и 7th Ave

Две островные платформы

F, L, M все время, кроме поздней ночи, 1,3 все время, кроме поздней ночи

Метро, ​​местная и экспресс-станция

Chambers St

Чемберс-стрит и У. Бродвей, Чемберс-стрит и Хадсон-стрит

Две островные платформы

1,3 всегда, кроме поздней ночи

Метро, ​​местная и экспресс-станция, ADA доступно

Park Place

Park Place and Broadway, Park Place and Church St

Платформа с одним островом

A, C все время, кроме поздней ночи, E, R, W только в будние дни, 3 все время, кроме поздней ночи

Метро, ​​местная станция

Fulton St

Фултон-стрит и Уильям-стрит, Джон-стрит и Уильям-стрит

Платформа с одним островом

A, C все время, кроме поздней ночи, J, Z только в час пик, 3 все время, кроме поздней ночи, 4, 5 все время, кроме поздней ночи

Метро, ​​местная станция, ADA доступно

Wall St

Уолл-стрит и Уильям-стрит, Пайн-стрит и Уильям-стрит, Сидар-стрит и Уильям-стрит

Платформа с одним островом

3 раза, кроме поздней ночи

Метро, ​​местная станция

Международный пакт о гражданских и политических правах

Арабский | Китайский | Французский | Русский | Испанский

Текст в формате PDF

Международный пакт о гражданских и политических правах


Принята и открыта для подписания, ратификации и присоединения резолюцией 2200A (XXI) Генеральной Ассамблеи от 16 декабря 1966 года.


вступила в силу 23 марта 1976 года в соответствии со статьей 49.

считая, что в соответствии с принципами, провозглашенными в Уставе Организации Объединенных Наций, признание достоинства, присущего всем членам человеческой семьи, а также равных и неотъемлемых прав является основой свободы, справедливости и мира во всем мире,

Признавая, что эти права проистекают из достоинства, присущего человеческой личности,

Признавая, что в соответствии со Всеобщей декларацией прав человека идеал свободных людей, пользующихся гражданской и политической свободой и свободой от страха и нужды, может только быть достигнутым, если будут созданы условия, при которых каждый может пользоваться своими гражданскими и политическими правами, а также своими экономическими и социальными правами. l и культурные права,

Принимая во внимание обязанность государств по Уставу Организации Объединенных Наций содействовать всеобщему уважению и соблюдению прав и свобод человека,

Осознавая, что человек, имеющий обязанности перед другими людьми и обществом к которой он принадлежит, несет ответственность за продвижение и соблюдение прав, признанных в настоящем Пакте,

Согласитесь со следующими статьями:

ЧАСТЬ I

Статья 1

1.Все народы имеют право на самоопределение. В силу этого права они свободно определяют свой политический статус и свободно осуществляют свое экономическое, социальное и культурное развитие.

2. Все народы могут в своих целях свободно распоряжаться своими природными богатствами и ресурсами без ущерба для любых обязательств, вытекающих из международного экономического сотрудничества, основанного на принципе взаимной выгоды и международного права. Ни в коем случае нельзя лишать народ собственных средств существования.

3. Участвующие в настоящем Пакте государства, включая те, которые несут ответственность за управление несамоуправляющимися и подопечными территориями, содействуют реализации права на самоопределение и уважают это право в соответствии с положения Устава Организации Объединенных Наций.

ЧАСТЬ II

Статья 2

1. Каждое участвующее в настоящем Пакте государство обязуется уважать и обеспечивать всем лицам, находящимся на его территории и под его юрисдикцией, права, признанные в настоящем Пакте, без каких-либо различий, таких как расы, цвета кожи, пола, языка, религии, политических или иных взглядов, национального или социального происхождения, имущественного положения, рождения или другого статуса.

2. Если это еще не предусмотрено существующими законодательными или другими мерами, каждое участвующее в настоящем Пакте Государство обязуется предпринять необходимые шаги в соответствии со своими конституционными процедурами и положениями настоящего Пакта, чтобы принять такие законы или другие меры, которые могут потребоваться для реализации прав, признанных в настоящем Пакте.

3. Каждое участвующее в настоящем Пакте Государство обязуется:

а) обеспечить, чтобы любое лицо, права и свободы которого, признанные в настоящем Пакте, нарушаются, имело эффективное средство правовой защиты, несмотря на то, что нарушение было совершено лицами, действовавшими в официальная дееспособность;

(b) Обеспечить, чтобы право любого лица, требующего такого средства правовой защиты, определялось компетентными судебными, административными или законодательными органами, или любым другим компетентным органом, предусмотренным правовой системой государства, и развивать возможности средств судебной защиты;

(c) Для обеспечения того, чтобы компетентные органы применяли такие средства правовой защиты, когда они предоставляются.

Статья 3

Участвующие в настоящем Пакте государства обязуются обеспечивать равное право мужчин и женщин на пользование всеми гражданскими и политическими правами, изложенными в настоящем Пакте.

Статья 4

1. Во время чрезвычайного положения, которое угрожает жизни нации и существование которого официально провозглашается, участвующие в настоящем Пакте государства могут принимать меры в отступление от своих обязательств по настоящему Пакту в той степени, в которой это строго требуется остротой ситуации. при условии, что такие меры не противоречат их другим обязательствам по международному праву и не влекут за собой дискриминацию исключительно по признаку расы, цвета кожи, пола, языка, религии или социального происхождения.

2. В соответствии с этим положением не допускается отступление от статей 6, 7, 8 (параграфы I и 2), 11, 15, 16 и 18.

3. Любое участвующее в настоящем Пакте государство, пользующееся правом отступления, незамедлительно информирует другие участвующие в настоящем Пакте государства, через посредство Генерального секретаря Организации Объединенных Наций, о положениях, из которых оно исходит. отступления и причин, по которым это было задействовано. Дополнительное сообщение должно быть сделано через того же посредника о дате прекращения такого отступления.

Статья 5

1. Ничто в настоящем Пакте не может быть истолковано как подразумевающее для любого государства, группы или лица какое-либо право заниматься любой деятельностью или совершать какие-либо действия, направленные на уничтожение любого из признанных прав и свобод. здесь или при их ограничении в большей степени, чем это предусмотрено в настоящем Пакте.

2. Не допускается никаких ограничений или отступлений от каких-либо основных прав человека, признанных или существующих в любом государстве - участнике настоящего Пакта в соответствии с законом, конвенциями, постановлениями или обычаями под предлогом того, что настоящий Пакт не признает такие права. права или что он признает их в меньшей степени.

ЧАСТЬ III

Статья 6

1. Каждый человек имеет неотъемлемое право на жизнь. Это право охраняется законом. Никто не может быть произвольно лишен жизни.

2. В странах, которые не отменили смертную казнь, смертный приговор может выноситься только за самые тяжкие преступления в соответствии с законом, действующим на момент совершения преступления, и не противоречит положениям настоящего Пакта и Конвенции о предупреждении преступления геноцида и наказании за него.Это наказание может быть исполнено только на основании окончательного решения, вынесенного компетентным судом.

3. Когда лишение жизни представляет собой преступление геноцида, подразумевается, что ничто в этой статье не дает права любому участвующему в настоящем Пакте государству каким-либо образом отступать от любого обязательства, взятого на себя в соответствии с положениями Конвенции о предупреждении и защите прав человека. Наказание за преступление геноцида.

4. Каждый приговоренный к смертной казни имеет право ходатайствовать о помиловании или о смягчении приговора.Амнистия, помилование или смягчение приговора к смертной казни могут быть предоставлены во всех случаях.

5. Смертная казнь не выносится за преступления, совершенные лицами моложе восемнадцати лет, и беременным женщинам не выносится.

6. Ничто в настоящей статье не может использоваться для отсрочки или предотвращения отмены смертной казни каким-либо государством - участником настоящего Пакта.

Статья 7

Никто не должен подвергаться пыткам или жестоким, бесчеловечным или унижающим достоинство видам обращения или наказания.В частности, никто не должен без его свободного согласия подвергаться медицинским или научным экспериментам.

Статья 8

1. Никто не должен содержаться в рабстве; рабство и работорговля во всех их формах запрещены.

2. Никто не может содержаться в подневольном состоянии.

3.

а) Никто не должен принуждаться к принудительному или обязательному труду;

(b) Пункт 3 (а) не должен препятствовать в странах, где тюремное заключение с каторжными работами может быть назначено в качестве наказания за преступление, выполнение каторжных работ во исполнение приговора к такому наказанию компетентным корт;

(c) Для целей данного параграфа термин «принудительный или обязательный труд» не включает:

(i) Любую работу или услугу, не упомянутые в подпункте (b), обычно требуемые от лица, находящегося под задержание по законному постановлению суда или лица во время условного освобождения из-под стражи;

(ii) любая служба военного характера и, в странах, где признается отказ от военной службы по соображениям совести, любая национальная служба, требуемая законом об отказниках по соображениям совести;

(iii) Любая услуга, требуемая в случае чрезвычайной ситуации или бедствия, угрожающего жизни или благополучию общества;

(iv) Любая работа или служба, являющаяся частью обычных гражданских обязанностей.

Статья 9

1. Каждый имеет право на свободу и личную неприкосновенность. Никто не может быть подвергнут произвольному аресту или задержанию. Никто не может быть лишен свободы иначе как на таких основаниях и в соответствии с такой процедурой, которые установлены законом.

2. Каждому арестованному сообщаются во время ареста причины его ареста и незамедлительно сообщается любое предъявляемое ему обвинение.

3.Любой арестованный или задержанный по уголовному обвинению должен быть незамедлительно доставлен к судье или другому должностному лицу, уполномоченному законом осуществлять судебную власть, и имеет право на судебное разбирательство в разумные сроки или на освобождение. Содержание под стражей лиц, ожидающих суда, не является общим правилом, но освобождение может быть обусловлено гарантиями явки в суд на любой другой стадии судебного разбирательства и, в случае необходимости, для исполнения приговора.

4.Любой, кто лишен свободы в результате ареста или задержания, имеет право обратиться в суд, чтобы этот суд мог безотлагательно вынести решение о законности его задержания и распорядиться о его освобождении, если задержание незаконно.

5. Каждый, кто стал жертвой незаконного ареста или задержания, имеет право на компенсацию, имеющую исковую силу.

Статья 10

1. Со всеми лицами, лишенными свободы, следует обращаться гуманно и с уважением достоинства, присущего человеческой личности.

2.

a) Обвиняемые, за исключением исключительных обстоятельств, должны быть изолированы от осужденных и им предоставляется отдельный режим, соответствующий их статусу неосужденных лиц;

(b) Обвиняемые несовершеннолетние отделяются от взрослых и в кратчайшие сроки доставляются для вынесения приговора.

3. Пенитенциарная система включает лечение заключенных, основной целью которого является их исправление и социальная реабилитация.Несовершеннолетние правонарушители должны быть изолированы от взрослых и получать лечение, соответствующее их возрасту и правовому статусу.

Статья 11

Никто не может быть лишен свободы только на основании невозможности выполнить договорное обязательство.

Статья 12

1. Каждый, кто находится на территории государства на законных основаниях, имеет на этой территории право на свободу передвижения и свободу выбора места жительства.

2. Каждый может свободно покидать любую страну, в том числе свою собственную.

3. Вышеупомянутые права не подлежат никаким ограничениям, кроме тех, которые предусмотрены законом, необходимы для защиты национальной безопасности, общественного порядка (ordre public), здоровья или нравственности населения или прав и свобод других лиц. и согласуются с другими правами, признанными в настоящем Пакте.

4. Никто не может быть произвольно лишен права на въезд в свою страну.

Статья 13

Иностранец, законно находящийся на территории государства - участника настоящего Пакта, может быть выслан оттуда только во исполнение решения, принятого в соответствии с законом, и должен, за исключением случаев, когда веские причины национальной безопасности требуют иного, может быть разрешено представить причины против его высылки и чтобы его дело было рассмотрено и было представлено для этой цели перед компетентным органом или лицом или лицами, специально назначенными компетентным органом.

Статья 14

1. Все люди равны перед судами и трибуналами. Каждый имеет право на справедливое и публичное разбирательство дела в компетентном, независимом и беспристрастном суде, учрежденном на основании закона, при рассмотрении любого уголовного обвинения против него или его прав и обязанностей в рамках судебного процесса. Пресса и общественность могут быть исключены из всего или части судебного разбирательства по причинам морали, общественного порядка (ordre public) или национальной безопасности в демократическом обществе, или когда этого требуют интересы частной жизни сторон, либо в целях степень, строго необходимая, по мнению суда, в особых обстоятельствах, когда гласность нанесет ущерб интересам правосудия; но любое судебное решение, вынесенное по уголовному делу или судебному процессу, должно быть обнародовано, за исключением случаев, когда интересы несовершеннолетних требуют иного или когда судебное разбирательство касается супружеских споров или опеки над детьми.

2. Каждый обвиняемый в уголовном преступлении имеет право считаться невиновным до тех пор, пока его вина не будет доказана в соответствии с законом.

3. При рассмотрении любого уголовного обвинения против него каждый имеет право на следующие минимальные гарантии при полном равенстве: (a) Быстро и подробно проинформировать на понятном ему языке о характере и причине обвинение против него;

(b) иметь достаточное время и возможности для подготовки своей защиты и сноситься с выбранным им самим защитником;

c) предстать перед судом без неоправданной задержки;

(d) быть судимым в его присутствии и защищать себя лично или через юридическую помощь по своему выбору; быть проинформированным, если у него нет юридической помощи, об этом праве; и иметь назначенную ему юридическую помощь в любом случае, когда этого требуют интересы правосудия, и бесплатно с его стороны в любом таком случае, если у него нет достаточных средств для ее оплаты;

e) допросить или допросить свидетелей против него и добиться явки и допроса свидетелей от его имени на тех же условиях, что и свидетели против него;

(f) пользоваться бесплатной помощью переводчика, если он не понимает языка, используемого в суде, или не говорит на нем;

(g) Не быть принужденным к даче показаний против самого себя или к признанию вины.

4. В отношении несовершеннолетних процедура должна учитывать их возраст и желательность содействия их реабилитации.

5. Каждый осужденный за преступление имеет право на то, чтобы его осуждение и приговор были пересмотрены вышестоящей судебной инстанцией в соответствии с законом.

6. Когда лицо было окончательно осуждено за совершение уголовного преступления и впоследствии его приговор был отменен или он был помилован на том основании, что новый или недавно обнаруженный факт убедительно свидетельствует о том, что произошел выкидыш. правосудия, лицо, понесшее наказание в результате такого осуждения, должно получить компенсацию в соответствии с законом, если не будет доказано, что неразглашение неизвестного факта во времени полностью или частично связано с ним.

7. Никто не подлежит повторному суду или наказанию за преступление, за которое он уже был окончательно осужден или оправдан в соответствии с законом и уголовно-процессуальным законодательством каждой страны.

Статья 15

1. Никто не может быть признан виновным в совершении какого-либо уголовного преступления на основании любого действия или бездействия, которое не составляло уголовного преступления по национальному или международному праву в момент его совершения. Также не может быть назначено более суровое наказание, чем то, которое применялось во время совершения уголовного преступления.Если после совершения правонарушения законом предусмотрено наложение более мягкого наказания, правонарушитель получает от этого выгоду.

2. Ничто в настоящей статье не препятствует судебному разбирательству и наказанию любого лица за любое действие или бездействие, которое на момент его совершения являлось уголовным преступлением в соответствии с общими принципами права, признанными сообществом наций.

Статья 16

Каждый имеет право везде признаваться правосубъектным.

Статья 17

1. Никто не должен подвергаться произвольному или незаконному вмешательству в его частную жизнь, семью, жилище или корреспонденцию, а также незаконным посягательствам на его честь и репутацию.

2. Каждый имеет право на защиту закона от такого вмешательства или посягательств.

Статья 18

1. Каждый имеет право на свободу мысли, совести и религии.Это право включает свободу иметь или принимать религию или убеждения по своему выбору, а также свободу, индивидуально или совместно с другими, публично или в частном порядке, исповедовать свою религию или убеждения в богослужении, обрядах, обрядах и обучении.

2. Никто не должен подвергаться принуждению, ограничивающему его свободу иметь или принимать религию или убеждения по своему выбору.

3. Свобода исповедовать свою религию или убеждения может подлежать только таким ограничениям, которые предписаны законом и необходимы для защиты общественной безопасности, порядка, здоровья или нравственности или основных прав и свобод других лиц.

4. Участвующие в настоящем Пакте государства обязуются уважать свободу родителей и, в соответствующих случаях, законных опекунов, обеспечивать религиозное и нравственное воспитание своих детей в соответствии со своими собственными убеждениями.

Статья 19

1. Каждый имеет право беспрепятственно придерживаться своих убеждений.

2. Каждый имеет право свободно выражать свое мнение; это право включает свободу искать, получать и распространять информацию и идеи любого рода, независимо от государственных границ, в устной, письменной или печатной форме, в форме искусства или любыми другими средствами по своему выбору.

3. Осуществление прав, предусмотренных пунктом 2 настоящей статьи, влечет за собой особые обязанности и ответственность. Следовательно, на него могут накладываться определенные ограничения, но они должны быть только такими, которые предусмотрены законом и необходимы:

(a) Для уважения прав или репутации других лиц;

(b) Для защиты национальной безопасности или общественного порядка (ordre public), или общественного здоровья или нравственности.

Статья 20

1.Любая пропаганда войны запрещается законом.

2. Пропаганда национальной, расовой или религиозной ненависти, представляющая собой подстрекательство к дискриминации, вражде или насилию, запрещается законом.

Статья 21

Признается право на мирные собрания. На осуществление этого права не могут быть наложены никакие ограничения, кроме тех, которые налагаются в соответствии с законом и которые необходимы в демократическом обществе в интересах национальной безопасности или общественной безопасности, общественного порядка (ordre public), охраны здоровья населения. или мораль, или защита прав и свобод других лиц.

Статья 22

1. Каждый имеет право на свободу ассоциации с другими, включая право создавать профессиональные союзы и вступать в них для защиты своих интересов.

2. На осуществление этого права не могут быть наложены никакие ограничения, кроме тех, которые предусмотрены законом и необходимы в демократическом обществе в интересах национальной безопасности или общественной безопасности, общественного порядка (ordre public), защиты общественного здоровья или нравственности или защиты прав и свобод других лиц.Настоящая статья не препятствует наложению законных ограничений на военнослужащих и сотрудников полиции при осуществлении ими этого права.

3. Ничто в настоящей статье не уполномочивает государства-участники Конвенции Международной организации труда 1948 года о свободе ассоциации и защите права на организацию принимать законодательные меры, которые наносят ущерб, или применять закон таким образом, чтобы ущерб гарантиям, предусмотренным в этой Конвенции.

Статья 23

1. Семья является естественной и основной ячейкой общества и имеет право на защиту со стороны общества и государства.

2. Признается право мужчин и женщин брачного возраста на вступление в брак и создание семьи.

3. Ни один брак не может быть заключен без свободного и полного согласия вступающих в брак.

4. Участвующие в настоящем Пакте государства принимают соответствующие меры для обеспечения равенства прав и обязанностей супругов в отношении брака, во время брака и при его расторжении.В случае роспуска должна быть предусмотрена необходимая защита детей.

Статья 24

1. Каждый ребенок имеет, без какой-либо дискриминации по признаку расы, цвета кожи, пола, языка, религии, национального или социального происхождения, имущественного положения или рождения, право на такие меры защиты, которые требуются его статус несовершеннолетнего со стороны его семьи, общества и государства.

2. Каждый ребенок должен быть зарегистрирован сразу после рождения и иметь имя.

3. Каждый ребенок имеет право на получение гражданства.

Статья 25

Каждый гражданин должен иметь право и возможность, без каких-либо различий, упомянутых в статье 2, и без необоснованных ограничений:

(a) Принимать участие в ведении государственных дел, прямо или через посредство свободно избранные представители;

(b) голосовать и быть избранным на подлинных периодических выборах, которые будут проводиться на основе всеобщего и равного избирательного права и будут проводиться тайным голосованием, гарантирующим свободное волеизъявление избирателей;

(c) Иметь доступ на общих условиях равенства к государственной службе в своей стране.

Статья 26

Все люди равны перед законом и имеют право без всякой дискриминации на равную защиту закона. В этом отношении закон запрещает любую дискриминацию и гарантирует всем лицам равную и эффективную защиту от дискриминации по любому признаку, например по расе, цвету кожи, полу, языку, религии, политическим или другим убеждениям, национальному или социальному происхождению, собственности, рождению или другой статус.

Статья 27

В тех государствах, в которых существуют этнические, религиозные или языковые меньшинства, лицам, принадлежащим к таким меньшинствам, не может быть отказано в праве совместно с другими членами своей группы пользоваться своей культурой, исповедуют и исповедуют свою религию или используют свой язык.

ЧАСТЬ IV

Статья 28

1. Учреждается Комитет по правам человека (именуемый далее в настоящем Пакте Комитет). Он состоит из восемнадцати членов и выполняет функции, указанные ниже.

2. В состав Комитета входят граждане участвующих в настоящем Пакте государств, которые должны обладать высокими моральными качествами и признанной компетентностью в области прав человека, при этом учитывается полезность участия некоторых лиц, имеющих юридический опыт.

3. Члены Комитета избираются и выступают в личном качестве.

Статья 29

1. Члены Комитета избираются тайным голосованием из списка лиц, обладающих квалификацией, предусмотренной в статье 28, и выдвигаемых для этой цели участвующими в настоящем Пакте государствами.

2. Каждое участвующее в настоящем Пакте государство может назначить не более двух человек.Эти лица должны быть гражданами подавшего заявку государства.

3. Лицо имеет право на повторное выдвижение.

Статья 30

1. Первоначальные выборы проводятся не позднее чем через шесть месяцев после даты вступления в силу настоящего Пакта.

2. По крайней мере за четыре месяца до даты каждых выборов в Комитет, за исключением выборов для заполнения вакансии, объявленной в соответствии со статьей 34, Генеральный секретарь Организации Объединенных Наций направляет письменное приглашение государствам-участникам. к настоящему Пакту представить свои кандидатуры в члены Комитета в течение трех месяцев.

3. Генеральный секретарь Организации Объединенных Наций составляет в алфавитном порядке список всех выдвинутых таким образом лиц с указанием государств-участников, которые их выдвинули, и представляет его участвующим в настоящем Пакте государствам. не позднее, чем за месяц до даты каждых выборов.

4. Выборы членов Комитета проводятся на заседании участвующих в настоящем Пакте государств, созываемом Генеральным секретарем Организации Объединенных Наций в Центральных учреждениях Организации Объединенных Наций.На этом заседании, на котором две трети участвующих в настоящем Пакте государств составляют кворум, лицами, избранными в Комитет, являются те кандидаты, которые получили наибольшее количество голосов и абсолютное большинство голосов представителей государств. Присутствующие и голосующие стороны.

Статья 31

1. Комитет не может включать более одного гражданина одного и того же государства.

2. При выборах в Комитет следует учитывать справедливое географическое распределение членского состава и представительство различных форм цивилизации и основных правовых систем.

Статья 32

1. Члены Комитета избираются сроком на четыре года. Они могут быть переизбраны в случае повторного назначения. Однако срок полномочий девяти членов, избранных на первых выборах, истекает через два года; сразу после первых выборов имена этих девяти членов выбираются по жребию Председателем собрания, упомянутого в пункте 4 статьи 30.

2. Выборы по истечении срока полномочий проводятся в соответствии с предыдущими статьями этой части настоящего Пакта.

Статья 33

1. Если, по единодушному мнению других членов, член Комитета прекратил выполнять свои функции по любой причине, кроме отсутствия временного характера, Председатель Комитета должен уведомляет Генерального секретаря Организации Объединенных Наций, который затем объявляет место этого члена вакантным.

2. В случае смерти или отставки члена Комитета председатель немедленно уведомляет Генерального секретаря Организации Объединенных Наций, который объявляет место вакантным с даты смерти или даты, когда отставка вступает в силу.

Статья 34

1. Когда вакансия объявляется в соответствии со статьей 33 и если срок полномочий заменяемого члена не истекает в течение шести месяцев с момента объявления вакансии, Генеральный секретарь Организация Объединенных Наций уведомляет каждое из участвующих в настоящем Пакте Государств, которые могут в течение двух месяцев представить кандидатуры в соответствии со статьей 29 для заполнения вакансии.

2.Генеральный секретарь Организации Объединенных Наций составляет в алфавитном порядке список выдвинутых таким образом лиц и представляет его участвующим в настоящем Пакте государствам. Затем проводятся выборы для заполнения вакансии согласно соответствующим положениям этой части настоящего Пакта.

3. Член Комитета, избранный для заполнения вакансии, объявленной в соответствии со статьей 33, занимает должность в течение оставшегося срока полномочий члена, который освободил место в Комитете в соответствии с положениями этой статьи.

Статья 35

Члены Комитета с одобрения Генеральной Ассамблеи Организации Объединенных Наций получают вознаграждение из ресурсов Организации Объединенных Наций на таких условиях, которые Генеральная Ассамблея может решить с учетом важности обязанностей Комитета.

Статья 36

Генеральный секретарь Организации Объединенных Наций предоставляет необходимый персонал и помещения для эффективного выполнения функций Комитета в соответствии с настоящим Пактом.

Статья 37

1. Генеральный секретарь Организации Объединенных Наций созывает первое заседание Комитета в Центральных учреждениях Организации Объединенных Наций.

2. После первого заседания Комитет собирается в такое время, которое предусмотрено его правилами процедуры.

3. Комитет обычно собирается в штаб-квартире Организации Объединенных Наций или в Отделении Организации Объединенных Наций в Женеве.

Статья 38

Каждый член Комитета перед вступлением в должность должен сделать торжественное заявление в открытом комитете, что он будет выполнять свои функции беспристрастно и добросовестно.

Статья 39

1. Комитет избирает своих должностных лиц сроком на два года. Они могут быть переизбраны.

2. Комитет устанавливает свои собственные правила процедуры, но эти правила должны предусматривать, среди прочего, следующее:

(a) Двенадцать членов составляют кворум;

(b) Решения Комитета принимаются большинством голосов присутствующих членов.

Артикул 40

1.Участвующие в настоящем Пакте государства обязуются представлять доклады о принятых ими мерах, обеспечивающих осуществление признанных в нем прав, и о прогрессе, достигнутом в осуществлении этих прав: а) в течение одного года с момента вступления в силу настоящего Пакта. настоящий Пакт для заинтересованных Государств-участников;

(b) После этого по просьбе Комитета.

2. Все отчеты представляются Генеральному секретарю Организации Объединенных Наций, который передает их Комитету для рассмотрения.В отчетах должны указываться факторы и трудности, если таковые имеются, влияющие на выполнение настоящего Пакта.

3. Генеральный секретарь Организации Объединенных Наций может после консультации с Комитетом направить соответствующим специализированным учреждениям копии таких частей отчетов, которые могут входить в сферу их компетенции.

4. Комитет изучает доклады, представленные участвующими в настоящем Пакте государствами. Он препровождает свои отчеты и такие общие комментарии, которые он сочтет необходимыми, государствам-участникам.Комитет может также передать Экономическому и Социальному Совету эти комментарии вместе с копиями отчетов, полученных от государств - участников настоящего Пакта.

5. Участвующие в настоящем Пакте государства могут представлять Комитету замечания по любым комментариям, которые могут быть сделаны в соответствии с пунктом 4 настоящей статьи.

Статья 41

1. Государство-участник настоящего Пакта может в любое время заявить в соответствии с настоящей статьей, что оно признает компетенцию Комитета получать и рассматривать сообщения о том, что одно государство-участник утверждает, что другое государство-участник не выполняет свои обязательства по настоящему Пакту.Сообщения в соответствии с настоящей статьей могут приниматься и рассматриваться только в том случае, если они представлены государством-участником, сделавшим заявление о признании в отношении себя компетенции Комитета. Комитет не принимает никаких сообщений, если они касаются Государства-участника, которое не сделало такого заявления. Сообщения, полученные в соответствии с настоящей статьей, рассматриваются в соответствии со следующей процедурой:

(a) Если участвующее в настоящем Пакте Государство считает, что другое Государство-участник не выполняет положения настоящего Пакта, оно может: письменном сообщении, довести вопрос до сведения этого государства-участника.В течение трех месяцев после получения сообщения принимающее государство должно предоставить государству, которое направило сообщение, объяснение или любое другое заявление в письменной форме, разъясняющее вопрос, которое должно включать, насколько это возможно и уместно, ссылку на внутренние процедуры и принятые средства правовой защиты. , ожидающие рассмотрения или доступные по делу;

(b) Если вопрос не будет урегулирован к удовлетворению обоих заинтересованных Государств-участников в течение шести месяцев после получения государством-получателем первоначального сообщения, любое Государство имеет право передать этот вопрос в Комитет путем уведомления. передается Комитету и другому Государству;

(c) Комитет рассматривает переданный ему вопрос только после того, как он убедится, что все доступные внутренние средства правовой защиты были задействованы и исчерпаны по данному вопросу в соответствии с общепризнанными принципами международного права.Это не должно быть правилом, если применение средств правовой защиты неоправданно затягивается;

(d) Комитет проводит закрытые заседания при рассмотрении сообщений в соответствии с настоящей статьей;

(e) В соответствии с положениями подпункта (c) Комитет предоставляет свои добрые услуги заинтересованным Государствам-участникам с целью дружественного решения вопроса на основе уважения прав человека и основных свобод, как и признаны в настоящем Пакте;

(f) По любому переданному ему вопросу Комитет может призвать заинтересованные Государства-участники, упомянутые в подпункте (b), предоставить любую соответствующую информацию;

(g) Заинтересованные государства-участники, упомянутые в подпункте (b), имеют право быть представленными при рассмотрении вопроса в Комитете и делать представления устно и / или письменно;

(h) Комитет должен в течение двенадцати месяцев после даты получения уведомления в соответствии с подпунктом (b) представить отчет:

(i) Если решение в рамках подпункта (e) достигнуто, Комитет ограничивает свой отчет кратким изложением фактов и достигнутого решения;

(ii) Если решение в рамках подпункта (е) не достигается, Комитет ограничивает свой отчет кратким изложением фактов; письменные представления и запись устных представлений, сделанных заинтересованными государствами-участниками, прилагаются к докладу.По каждому вопросу отчет направляется заинтересованным Государствам-участникам.

2. Положения настоящей статьи вступают в силу, когда десять участвующих в настоящем Пакте государств сделают заявления в соответствии с пунктом I этой статьи. Такие заявления сдаются Государствами-участниками на хранение Генеральному секретарю Организации Объединенных Наций, который направляет их копии другим Государствам-участникам. Заявление может быть отозвано в любое время путем уведомления Генерального секретаря.Такой отзыв не наносит ущерба рассмотрению любого вопроса, который является предметом сообщения, уже переданного в соответствии с настоящей статьей; никакие дальнейшие сообщения от какого-либо государства-участника не принимаются после получения Генеральным секретарем уведомления об отзыве заявления, если только заинтересованное государство-участник не сделало нового заявления.

Статья 42

1.

(a) Если вопрос, переданный Комитету в соответствии со статьей 41, не разрешен к удовлетворению заинтересованных Государств-участников, Комитет может с предварительного согласия Государств Заинтересованные стороны назначают специальную Примирительную комиссию (далее именуемую Комиссией).Добрые услуги Комиссии предоставляются заинтересованным Государствам-участникам с целью полюбовного решения вопроса на основе уважения настоящего Пакта;

(b) Комиссия состоит из пяти человек, приемлемых для заинтересованных Государств-участников. Если заинтересованные государства-участники не достигают соглашения в течение трех месяцев относительно всего или части состава Комиссии, члены Комиссии, в отношении которых не было достигнуто соглашения, избираются тайным голосованием большинством в две трети голосов от общего числа голосов. Комитет из числа своих членов.

2. Члены Комиссии выступают в личном качестве. Они не должны быть гражданами заинтересованных Государств-участников или Государства, не являющегося участником настоящего Пакта, или Государства-участника, которое не сделало заявления в соответствии со статьей 41.

3. Комиссия избирает своего собственного председателя и принимает свои собственные правила процедуры.

4. Заседания Комиссии обычно проводятся в Центральных учреждениях Организации Объединенных Наций или в Отделении Организации Объединенных Наций в Женеве.Однако они могут проводиться в других удобных местах, которые Комиссия может определить в консультации с Генеральным секретарем Организации Объединенных Наций и заинтересованными государствами-участниками.

5. Секретариат, предоставляемый в соответствии со статьей 36, также обслуживает комиссии, назначенные в соответствии с этой статьей.

6. Информация, полученная и сопоставленная Комитетом, предоставляется Комиссии, и Комиссия может обратиться к заинтересованным Государствам-участникам с просьбой предоставить любую другую соответствующую информацию.

7. Когда Комиссия полностью рассмотрит вопрос, но в любом случае не позднее, чем через двенадцать месяцев после рассмотрения вопроса, она представляет Председателю Комитета отчет для передачи заинтересованным государствам-участникам:

(a) Если Комиссия не может завершить рассмотрение вопроса в течение двенадцати месяцев, она ограничивает свой отчет кратким изложением статуса рассмотрения ею вопроса;

(b) Если будет достигнуто полюбовное решение вопроса на основе уважения прав человека, признанных в настоящем Пакте, Комиссия ограничит свой доклад кратким изложением фактов и достигнутого решения;

(c) Если решение в рамках подпункта (b) не достигнуто, в отчете Комиссии должны быть отражены ее выводы по всем фактическим вопросам, имеющим отношение к разногласиям между заинтересованными Государствами-участниками, и ее взгляды на возможности мировое решение вопроса.Этот отчет также должен содержать письменные представления и запись устных представлений, сделанных заинтересованными государствами-участниками;

(d) Если отчет Комиссии представлен в соответствии с подпунктом (c), заинтересованные государства-участники в течение трех месяцев с момента получения отчета уведомляют председателя Комитета о том, принимают ли они содержание отчета или нет. Комиссия.

8. Положения этой статьи не наносят ущерба ответственности Комитета в соответствии со статьей 41.

9. Заинтересованные государства-участники в равной степени несут все расходы членов Комиссии в соответствии со сметой, представленной Генеральным секретарем Организации Объединенных Наций.

10. Генеральный секретарь Организации Объединенных Наций имеет право оплачивать расходы членов Комиссии, если это необходимо, до их возмещения заинтересованными Государствами-участниками в соответствии с пунктом 9 настоящей статьи.

Статья 43

Члены Комитета и специальных согласительных комиссий, которые могут быть назначены в соответствии со статьей 42, имеют право на льготы, привилегии и иммунитеты экспертов в командировках от Организации Объединенных Наций, как это изложено в соответствующих разделах Конвенции о привилегиях и иммунитетах Объединенных Наций.

Статья 44

Положения об осуществлении настоящего Пакта применяются без ущерба для процедур, предписанных в области прав человека учредительными документами и конвенциями Организации Объединенных Наций и специализированных учреждений и не препятствует участвующим в настоящем Пакте государствам прибегать к другим процедурам урегулирования спора в соответствии с действующими между ними общими или специальными международными соглашениями.

Статья 45

Комитет представляет Генеральной Ассамблее Организации Объединенных Наций через Экономический и Социальный Совет годовой отчет о своей деятельности.

ЧАСТЬ V

Статья 46

Ничто в настоящем Пакте не должно толковаться как нарушающее положения Устава Организации Объединенных Наций и конституций специализированных учреждений, которые определяют соответствующие обязанности различных органов Организации Объединенных Наций и специализированные учреждения в отношении вопросов, рассматриваемых в настоящем Пакте.

Статья 47

Ничто в настоящем Пакте не может быть истолковано как ущемление неотъемлемого права всех народов в полной мере и свободно пользоваться своими природными богатствами и ресурсами.

ЧАСТЬ VI

Статья 48

1. Настоящий Пакт открыт для подписания любым государством - членом Организации Объединенных Наций или членом любого из ее специализированных учреждений, любым государством - участником Статута Международного Суда и любое другое государство, которое было приглашено Генеральной Ассамблеей Организации Объединенных Наций стать участником настоящего Пакта.

2. Настоящий Пакт подлежит ратификации. Ратификационные грамоты сдаются на хранение Генеральному секретарю Организации Объединенных Наций.

3. Настоящий Пакт открыт для присоединения любого государства, указанного в пункте 1 настоящей статьи.

4. Присоединение осуществляется путем сдачи на хранение документа о присоединении Генеральному секретарю Организации Объединенных Наций.

5. Генеральный секретарь Организации Объединенных Наций информирует все государства, подписавшие настоящий Пакт или присоединившиеся к нему, о сдаче на хранение каждой ратификационной грамоты или документа о присоединении.

Статья 49

1. Настоящий Пакт вступает в силу через три месяца после даты сдачи на хранение Генеральному секретарю Организации Объединенных Наций тридцать пятой ратификационной грамоты или документа о присоединении.

2. Для каждого государства, ратифицировавшего настоящий Пакт или присоединившегося к нему после сдачи на хранение тридцать пятой ратификационной грамоты или документа о присоединении, настоящий Пакт вступает в силу через три месяца после даты сдачи на хранение его собственного документа. ратификационной грамоты или документа о присоединении.

Статья 50

Положения настоящего Пакта распространяются на все части федеративных государств без каких-либо ограничений или исключений.

Статья 51

1. Любое участвующее в настоящем Пакте государство может предложить поправку и подать ее Генеральному секретарю Организации Объединенных Наций. Генеральный секретарь Организации Объединенных Наций затем направляет любые предложенные поправки участвующим в настоящем Пакте государствам с просьбой уведомить его, выступают ли они за созыв конференции государств-участников с целью рассмотрения этих предложений и голосования по ним.Если по крайней мере одна треть государств-участников выскажется за такую ​​конференцию, Генеральный секретарь созывает конференцию под эгидой Организации Объединенных Наций. Любая поправка, принятая большинством государств-участников, присутствующих и участвующих в голосовании на конференции, представляется Генеральной Ассамблее Организации Объединенных Наций для утверждения.

2. Поправки вступают в силу после того, как они будут одобрены Генеральной Ассамблеей Организации Объединенных Наций и приняты большинством в две трети участвующих в настоящем Пакте государств в соответствии с их соответствующими конституционными процедурами.3. Когда поправки вступают в силу, они становятся обязательными для тех Государств-участников, которые их приняли, а другие Государства-участники по-прежнему связаны положениями настоящего Пакта и любой ранее принятой поправкой.

Статья 52

1. Независимо от уведомлений, сделанных в соответствии с пунктом 5 статьи 48, Генеральный секретарь Организации Объединенных Наций сообщает всем государствам, указанным в пункте I той же статьи, следующие сведения:

а) подписания, ратификации и присоединения согласно статье 48;

b) дате вступления в силу настоящего Пакта согласно статье 49 и дате вступления в силу любых поправок согласно статье 51.

Статья 53

1. Настоящий Пакт, английский, испанский, китайский, русский и французский тексты которого являются равно аутентичными, будет сдан на хранение в архивы Организации Объединенных Наций.

2. Генеральный секретарь Организации Объединенных Наций направит заверенные копии настоящего Пакта всем государствам, указанным в статье 48.

15 Свода законов США, § 1681s – 2 - Обязанности поставщиков информации агентствам по информированию потребителей | U.S. Код | Поправки к Закону США

2020 — Подсек. (а) (1) (F). Паб. Л. 116–136, доп. (F).

2018 — Подст. (а) (1) (Е). Паб. Л. 115–174, доп. (E).

2010 - п. (а) (7) (D). Паб. L. 111–203, §1088 (a) (11) (A), добавлен подпункт. (D) и вычеркнуты бывшие неполные. (D) что связано с обязанностью Правления предписывать типовое раскрытие информации.

Подсек. (а) (8) (А). Паб. L. 111–203, §1088 (a) (11) (B), который направил поправку в подпункт. (A) путем вставки слов «по согласованию с Федеральной торговой комиссией, федеральными банковскими агентствами и Национальной администрацией кредитных союзов» перед словами «должны совместно» было выполнено путем вставки перед словом «предписывает», чтобы отразить вероятные намерение Конгресса и поправка Pub.L. 111–203, §1088 (a) (2) (D). См. ниже.

Паб. L. 111–203, §1088 (a) (2) (D), замененный «Бюро» на «Федеральные банковские агентства, Национальная администрация кредитных союзов и Комиссия должны совместно».

Подсек. (е). Паб. L. 111–203, §1088 (a) (11) (C), добавлен подст. (e) и вычеркнуты бывшие подст. (e) которые связаны с установлением и поддержанием руководящих принципов по точности и предписаниям правил выполнения федеральными банковскими агентствами, Национальной администрацией кредитных союзов и Комиссией.

2003 - п. (а) (1) (А). Паб. L. 108–159, §312 (b) (1), заменено «знает или имеет разумные основания полагать, что информация неточна» на «знает или сознательно избегает знать, что информация неточна».

Подсек. (а) (1) (D). Паб. L. 108–159, §312 (b) (2), добавлен подпункт. (D).

Подсек. (а) (5). Паб. L. 108–159, §312 (d), существующие положения определены как подпункт. (A), вставлен заголовок, вставлена ​​«дата просрочки по счету, которая должна быть» перед «месяцем» и «по счету» перед «непосредственно предшествующим» и добавлен подпункт.(В).

Подсек. (а) (6). Паб. L. 108–159, §154 (a), добавлен п. (6).

Подсек. (а) (7). Паб. L. 108–159, §217 (a), добавлен п. (7).

Подсек. (а) (8). Паб. L. 108–159, §312 (c), добавлен п. (8).

Подсек. (а) (9). Паб. L. 108–159, §412 (a), добавлен п. (9).

Подсек. (б) (1) (Д). Паб. L. 108–159, §314 (b), добавлен подпункт. (E).

Подсек. (c). Паб. L. 108–159, §312 (e) (1), добавлен подст. (c) и вычеркнутый заголовок и текст бывшего подст.(c). Текст гласит: «Разделы 1681n и 1681o этого заголовка не применяются к любому несоблюдению подраздела (a) этого раздела, за исключением случаев, предусмотренных в разделе 1681s (c) (1) (B) этого заголовка».

Подсек. (г). Паб. L. 108–159, §312 (e) (1), добавлен подст. (d) и вычеркнутый заголовок и текст бывшего подст. (г). Текст гласит: «Подраздел (а) этого раздела должен применяться исключительно в соответствии с разделом 1681s этого раздела федеральными агентствами и должностными лицами, а также должностными лицами штата, указанными в этом разделе.”

Подсек. (е). Паб. L. 108–159, §312 (a), добавлен подст. (е).

Типовая форма раскрытия информации

Паб. L. 108–159, раздел II, §217 (b), 4 декабря 2003 г., 117 Stat. 1987 г., при условии, что:

«До окончания шестимесячного периода, начиная с даты вступления в силу настоящего Закона [Дек. 4, 2003], Правление должно принять образец раскрытия информации, требуемый в соответствии с поправкой, внесенной в подраздел (а) [поправка к этому разделу], после уведомления, должным образом представленного в Федеральном реестре, и возможности для общественного обсуждения в соответствии с разделом 553 раздела 5, Кодекс Соединенных Штатов.”

[Для определений терминов, используемых в разделе 217 (b) Pub. L. 108–159, изложенное выше, см. Раздел 2 Pub. L. 108–159, изложенный в примечании к определениям в разделе 1681 настоящего заголовка.]

клинических характеристик 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай | Реанимационная медицина | JAMA

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом (2019-nCoV) 2019 г., в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов потребовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Объектив Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения - 3 февраля 2020 г.

Открытия Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача в больнице подозревалась, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах 42-68; диапазон 22-92 года) и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали жар (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) - у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации - 7,0 дней и до ОРДС - 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и значимость В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Заболевание быстро распространилось из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента в Ухани и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенетический анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS) у человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Huang et al. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин от NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были включены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические результаты (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или если при электрокардиографии и эхокардиографии были выявлены новые отклонения от нормы. 9 Для пациентов, поступивших в отделение интенсивной терапии, в день поступления в отделение интенсивной терапии определялись баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача инфекции в больнице подозревалась, если в течение определенного периода времени заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и возможный источник инфекции можно было отследить.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазка из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для сохранения вируса, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы во время анализа RT-PCR в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 '. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 '. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ RT-PCR выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд, а также расширение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием тестов независимых групп t , когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двусторонний α менее 0,05 считался статистически значимым. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощь в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, брюшную полость. боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не поступившими в отделение интенсивной терапии, имелись многочисленные различия, включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ - медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление уровня кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт. Ст. (IQR, 103–234).

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Всего было выписано 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями были шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Для определения основных клинических признаков, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов была выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 - из терапевтического и 5 - из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) - в отделении неотложной помощи и 2 (5%) - в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников в этом отделении заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одном отделении были инфицированы, и у всех были выявлены атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой крупнейшую на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в лечении в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования свидетельствуют о возможности быстрой передачи вируса 2019-nCoV от человека к человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется среди новых людей, она воспроизводится; R 0 указывает среднее количество дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что свидетельствует о том, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с нетипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не поступавшие в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение заключается в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам определить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании были на ранней стадии эпидемии NCIP, а текущие случаи - из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не входящими в ОИТ, пациенты, которые получали лечение в ОИТ, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До настоящего времени не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование мер индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передача / инфекция в больнице не могла быть окончательно доказана, но предполагалась и предполагалась на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение интенсивной терапии (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктор Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, К. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Ченг, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарственных средств в крупном национальном масштабе. Научно-технические проекты Китая (2020ZX09201007 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Infect Dis . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресса: берлинское определение. JAMA . 2012; 307 (23): 2526-2533. DOI: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой почечной недостаточности. Почки Int Suppl . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система - потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv 927806. DOI: 10.1101 / 2020.01.30.927806 .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *