Сажевый фильтр на дизеле газель камминз: Обслуживание клапана ЕГР ГАЗель NEXT (Некст) Cummins 2.8 ЕВРО-5 в Ростове-на-Дону

Содержание

Дизель Cummins для российских LCV «ГАЗель» и УАЗ – Рейс.РФ

Менее чем за 10 лет поставок в Россию двигателей Cummins ISF 2.8, продано более 200 тысяч дизельных «ГАЗелей» и «Соболей» различных моделей и модификаций

Не так давно мы рассказали о реалиях и перспективах применения дизельных двигателей на легких коммерческих автомобилях Горьковского и Ульяновского автозаводов. Вспомнили, какими моторами комплектовали УАЗы и «ГАЗели» ранее, и какие идут на конвейеры сейчас. Сегодня подробней поговорим об одном из них.

Десять лет в России

Именно благодаря двигателю Cummins ISF 2.8, «ГАЗель» стала полноценным и, главное, ​массовым дизельным грузовичком. Осенью 2010 года, с выводом на российский рынок «ГАЗели-Бизнес», на нижегородскую полуторку начали устанавливать дизели ISF 2.8 мощностью 120 л.с. при 3200 об/мин, с моментом 270 Н.м при 1600-2700 об/мин. Параллельно выпускали и бензиновые версии с ульяновскими моторами. На «ГАЗелях» используют практически минимальную из имеющихся у Cummins ISF 2.

8 настройку мощности. Есть еще варианты 131, 150 и 163 л.с., крутящий момент до 360 Н.м. Позже 120-сильный дизель начали устанавливать на шасси и бортовые «ГАЗель Next», а на цельнометаллический фургон поставили ISF 2.8 увеличенной до 150 л.с. мощности, 330 Н.м, который, как говорили, станет здесь основным мотором. Теперь его устанавливают и на «тяжелую» «ГАЗель» полной массой 4,6 тонны.
   Как бы то ни было, а менее чем за 10 лет поставок в Россию Cummins ISF 2.8, уже продано более 200 тысяч дизельных «ГАЗелей» и «Соболей» различных моделей и модификаций. В зависимости от спроса и ситуации на рынке, в год выпускают от 20 до 30 тысяч нижегородских LCV с дизелями Cummins. То есть 30-50  % от годового выпуска – ​это дизельные машины. А, например, в 2019 году Горьковский автозавод изготовил 63 910 автомобилей «ГАЗель».

От Азии до Америки

Cummins ISF 2.8 выпускают в Китае, на заводе Beijing Foton Cummins Engine Company Limited (BFCEC). Это совместное предприятие Foton и Cummins.

которое находится в Пекине. Проектная мощность 400 тысяч двигателей в год, из них 250 тысяч – ISF 2.8 и 150 тысяч – ISF 3.8. Поясним: ISF 3.8 конструктивно совсем другой мотор, близкий к «четверкам» Cummins В. Кроме китайских грузовиков и LCV марок Foton, CNHTC и JAC, двигатели поставляют в Бразилию, на местное подразделение MAN.
   В России Cummins ISF 2.8 уже давно стал привычным на «ГАЗелях». Такого результата Горьковскому автозаводу не дало партнерство ни с одним из производителей дизелей малого объема. Интересно, что на полноприводных «ГАЗелях» с этим мотором успешно выступает гоночная команда «ГАЗ Рейд Спорт». Там его форсируют до 200 л.с. Еще одно новое и неожиданное направление – ​применение двигателей Cummins на «Соболях» 4х4, которые используют любители рыбалки, охоты и просто внедорожных путешествий, как альтернативу ульяновской «буханке».

Плюсы и минусы

   Среди достоинств маленького «Камминз» – ​высокая мощность, компактность и сравнительно небольшой вес. У него цепной привод ГРМ, более надежный, чем зубчатым ремнем, головка блока 16-ти клапанная, при этом она чугунная, ​не боится перегрева, у нее нет термических трещин между седлами клапанов. Из недостатков – ​пластмассовый поддон картера двигателя. Правда, пластмасса ​высокопрочная, пробить поддон – ​надо постараться. Топливная аппаратура Common Rail производства Bosch, турбины Holset. Ранее для России и стран СНГ моторы Cummins ISF 2.8 шли в исполнении Евро-4 с рециркуляцией EGR, с нейтрализатором и обычной «неуправляемой» турбиной. Для агрегатов уровня Евро‑5, поставляемых сейчас в Нижний Новгород, используется турбокомпрессор с изменяемой геометрией VGT, рециркуляция EGR с жидкостным теплообменником и сажевый фильтр. Между тем, у Cummins есть версии ISF 2.8 Евро‑5 с нейтрализацией водным раствором мочевины AdBlue.

   Казалось бы, есть возможность установки двигателя Cummins ISF 2.8 и на УАЗы, тем более, что по габаритам он близок к 16-клапанным моторам ЗМЗ. Да и «Камминзу» должно быть выгодно увеличение поставок в Россию. А для автоперевозчиков и владельцев «УАЗ-Профи» он хорош экономичностью и налаженным сервисом. Оказывается, была одна-единственная попытка установить виртуальный ISF 2.8, то есть на компьютере в 3D. Возникли проблемы с корейской коробкой, и на этом все закончилось. Между тем, Cummins ISF 2.8 ставят на УАЗы различные фирмы, занимающиеся тюнингом, а на гоночных «ГАЗелях» стоят ISF 2.8 именно с этой корейской КП Dymos. Обычно коробку ставят через переходную плиту, но заводу лучше бы сделать оригинальный картер маховика. Наверняка, выпуск УАЗов с Cummins параллельно с ЗМЗ‑514 и бензиновым ЗМЗ «Про» не помешает продажам.

Какие еще моторы ставят на легкие коммерческие автомобили «ГАЗель» и УАЗ? Следите за публикациями.

Инструкция по самостоятельной замене моторного масла в двигателе Газель Next Cummins


Моторное масло оберегает ДВС от преждевременного износа, формируя защитный покров на деталях в виде тонкой плёнки. Эта оболочка помогает сократить трение поверхностей, выводит грязь, ржавчину, пыль и другие вредоносные вещества. Также жидкость равномерно распределяет тепло по всей системе.

Совсем недавно производители моторных масел стали добавлять в синтетические растворы разнообразные добавки, которые способны значительно увеличить срок службы мотора. Однако даже такая смесь со временем изнашивается и подлежит замене. Как сменить жидкость ДВС в автомобиле Газель Некст своими руками, читайте подробнее в статье ниже.

Выбираем моторное масло для двигателя Газель Некст (ГАЗель NEXT)

Renumax- уникальное средство для удаления царапин! Не тратьте деньги на перекраску! Теперь Вы сами сможете всего за 5 секунд убрать любую царапину с кузова Вашего автомобиля.

Революционный продукт от японской компании Wilsson Silane Guard – инновационное водоотталкивающее покрытие, придающее кузову автомобиля сияющий блеск до 1 года.

Газель Некст пользуется большой популярностью у российских автолюбителей. Этот малотоннажный автомобиль был разработан на Горьковском заводе и выпущен в серийное производство в 2013 году. Новая версия Газели была оборудована безопасной и комфортабельной кабиной, а также независимой подвеской и рулевым механизмом с гидравлическим усилителем.

Для полноценной работоспособности двигателя Газели Next необходимо использовать качественное масло на базе минеральных или синтезированных веществ. Согласно техническому регламенту, замена моторной жидкости в российском автомобиле выполняется по достижению 10-15 тыс. км пробега.

В зависимости от типа установленного двигателя объем заливки масла составляет 10 литров. Как правило, автолюбители используют две 5-литровые канистры. Для бесперебойной эксплуатации двигателя рекомендуется заливать полусинтетику с индексом вязкости 10w40.

Рекомендуемые масла:

  • Мобил Дельвак;
  • Лукойл Люкс;
  • Маннол;
  • Магнум Ультратек;
  • Ниссан.

Оптимальные масла для Газели Некст

Для системы ДВС на дизельном топливе рекомендуется использовать полусинтетическое или минеральное масло с вязкостью 10w40. Чтобы обеспечить длительную работоспособность двигателя модели Камминз 2,8 л., завод-изготовитель рекомендует использовать смазки:

  • Shell Helix HX7 10w40 дизель;
  • Shell Rimula R6;
  • Valvorin Blue 15w40.

Бензиновый агрегат УМЗ Эвотек 2,7, установленный на Газели Некст, нуждается в заливке полусинтетике с индексом вязкости 10w40 в летний период. В зимнее время рекомендуется использовать синтетическое масло с индексом вязкости 5w40.

Этот смазочный материал также можно использовать для всесезонного применения. В качестве альтернативного варианта подойдет Шелл Хеликс HX7 5w40.

Объемы заливки смазочного материала:

  • УМЗ Эвотек 2,7 – 4,5 литра;
  • Кумминс 2,8 – 6,5 литра.
Шелл Римула R6 10w40

Этот смазочный материал разработан на базе синтезированных веществ, с применением функциональных присадок для защиты системы ДВС от износа и загрязнений. Кроме того, качественное масло способно адаптироваться под агрессивное вождение.

Защита двигателя осуществляется благодаря активным молекулам смазки и уникальному рецепту масляного состава. Моторная жидкость сохраняет первоначальные свойства и при этом стабилизирует эксплуатационные характеристики ДВС между интервалами замены.

Масло Shell Rimula R6 предохраняет ДВС от износа на протяжении всего периода эксплуатации и обеспечивает чистоту на клапанах цилиндров и поршнях. Кроме того, смазка уменьшает топливный расход на Газели Некст и соответствует экологическим нормам Евро 4. Требования Евро 5 соблюдаются, если на Газели не установлены фильтра DPF.

Преимущества использования для Газели Некст:

  1. Экономия денежных средств на ТО автомобиля. Смазка разработана согласно требованиям производителей авто и удовлетворяет потребности MAN, Volvo, Mercedes-Benz, DAF, Газель Next. Это позволяет специалистам оптимизировать график ТО и увеличить функциональную работоспособность двигателя на протяжении длительного интервала замены автомасла.
  2. Комплексная очистка цилиндропоршневой группы. В составе Шелл Римула присутствуют технологичные присадки, гарантирующие чистоту цилиндров и поршней, а также моющие свойства масла на протяжении длительной эксплуатации. В результате продлевается рабочий ресурс мотора.
  3. Надежная защита механизмов от износа. Масло Шелл соответствует уровням защиты от изнашивания и подходит для европейских, японских и американских моделей двигателей. Предохраняет цилиндры от скольжения и уменьшает износ газораспределительной системы двигателя. Таким образом, увеличивается эксплуатационный период работы.

Кроме того, Shell Rimula R6 позволяет экономить на покупке топлива благодаря моментальной циркуляции по системе и очистки внутренних механизмов двигателя.

Шелл Хеликс HX7 10w40

Этот смазочный материал разработан для легковых и малотоннажных автомобилей с установленными двигателями на дизельном и бензиновом топливе. Рекомендуется для применения в условиях городской езды.

Также продукт может использоваться для двигателей, работающих на смесях этанола и биодизеля. Отличные смазывающие характеристики и свойства очистки достигаются за счет введения в состав синтезированных и натуральных веществ.

Стоит отметить, что компания Shell создает минеральные масла на основе природного газа, вследствие чего они получаются абсолютно чистыми и безопасными для двигательной системы. Поэтому такие смазки рекомендованы производителем Газели Некст.

Уникальная технология Pure Plus и моющие присадки Active Cleaning обеспечивают чистоту внутренних механизмов на Газели Некст. Идеальная чистота достигается благодаря использованию синтетических продуктов. Масло Shell Helix HX7 не обеспечивает комплексную очистку, но омывает двигатель от загрязнений и сохраняет его функциональность.

Преимущества использования смазки в ДВС Газели Некст:

  • минеральная и синтезированная основа масла в комплексе с присадками позволяет обеспечивать защиту двигателя от износа и уменьшает силу трения на поверхностях деталей;
  • улучшенные технические характеристики по сравнению с минеральными и синтетическими маслами;
  • сохранение первоначальных функций независимо от температурных условий, что допускает применение в различных климатических зонах;
  • аккуратная очистка системы ДВС от шлаков и нагара;
  • стабильные показатели вязкости даже при резких перепадах температур или эксплуатационных условиях;
  • быстрый запуск при сильных морозах;
  • уменьшение коррозии и стойкость к процессам окисления;
  • универсальность смазки позволяет ее заливать в любые типы движка, независимо от видов горючего материала;
  • длительный период эксплуатации двигателя и отдельных механизмов.

Отдельно стоит выделить существенное сокращение масляного и топливного расхода.

Минеральная смазка Valvorin Blue 15w40

Разработана для силовых агрегатов малотоннажных автомобилей, таких как Газелей Некст, работающих на дизтопливе. Предназначена для суровых эксплуатационных условий и рекомендована компанией Кумминс. Вальворин Блю обеспечивает смазку внутренних механизмов ДВС, независимо от установленных систем отработанных газов EGR.

Сфера применения:

  • малотоннажные автомобили с установленной системой прочистки отработанных газов;
  • грузовая техника со средними и удлиненными интервалами замены масла.

Valvorin с вязкостью 15w40 рекомендуется для двигателей Cummins, установленных в Газелях Некст. Обеспечивает стабильную работу тяжелых и малотоннажных автомобилей, а также других видов техники. Инновационный состав Вальворин Блю рассчитан на средние и увеличенные интервалы замены, за счет чего улучшается эксплуатационный ресурс движка.

Щелочное число TBN. Смазочный продукт Valvorin обладает повышенным содержанием щелочей и разработан согласно требованиям для дизельных моторов по классификации ACEA, API и производителей автотехники.

Улучшенные свойства защиты от сажевых накоплений. Моторное масло предохраняет систему ДВС, а также продлевает ее эксплуатационный период. Уникальный состав Вальворин Блю уменьшает износ и силу трения деталей за счет быстрой циркуляции по системе ДВС и формирования прочной микропленки.

Очищает масляный фильтр от засоров и сажи. Кроме того, обеспечивает контроль над высокотемпературными отложениями, формируемыми на поршневых кольцах, а также их защита от дальнейших загрязнений.

Смазка рекомендована для систем ДВС с установленными механизмами очистки газов и каталитического восстановления, а также двигателей, работающих по стандартам Евро 4 без фильтров DPF.

Моторная жидкость Вальворин Блю рекомендована компанией Кумминс. Это одно из немногих моторных масел на минеральной основе, которое обеспечивает функциональную работу двигателя Газели Некст.

Car-Fix – набор для удаления вмятин авто. Уникальная, запатентованная форма скобы исключает дополнительные повреждения, а клей после устранения вмятин можно легко удалить.

Набор Windshield Repair Kit разработан специально для самостоятельного ремонта трещины на лобовом стекле. Характерная особенность этого клея – его потрясающе низкая вязкость, очень близкая к вязкости воды. Благодаря этому он под действием капиллярных сил легко заполняет трещину.

prem-motors.ru

Какое масло заливать в Газель?

«Какое масло заливать в Газель?», — спрашивают автомобилисты, оценив преимущества этих вместительных и маневренных транспортных средств. Так, действительно, автомобиль марки «Газель» прочно вошли в нашу жизнь. В них сочетается удобство и неприхотливость. Хорошая грузоподъемность, габариты, доступная цена, минимальные затраты на обслуживание – все это подходит как водителям, так и пассажирам. Автомобиль марки «Газель» имеет несколько модификаций, начиная от обычного грузовика и заканчивая вместительным микроавтобусом класса люкс. Как и любой автомобиль, Газель нуждается в регулярном техническом обслуживании, в особенности, в замене расходных материалов. В нашей статье речь пойдет о замене масла и других технических жидкостей в автомобиле Газель.

Какое моторное масло лучше заливать в двигатель Газель летом Некст?

Рассматривая данную модификацию авто, необходимо знать, какое моторное масло лучше заливать в двигатель Газель летом Некст? ГАЗель NEXT спроектирован российскими инженерами с учетом требований миллионов потребителей. Этот автомобиль используется в различных видах деятельности. Он обеспечивает решение широкого комплекса транспортных задач с минимальными затратами. Замена масла в двигателе ГАЗель NEXT является обязательной процедурой, выполнять которую необходимо строго по регламенту. Производитель рекомендует проводить замену масла в двигателях Газели каждые 10-15 000 километров пробега. Независимо от того, бензиновый двигатель или дизельный, для его замены требуется 10 литров масла.

Владельцы Газели отдают предпочтение маслу со степенью вязкости 10W40, которое можно применять как летом, так и зимой.

Предлагаем список наиболее востребованных масел, которые обычно заливают в Газели, в том числе, в ГАЗель NEXT:

  • ОЙЛ ЛЮКС 10w-40;
  • Шел хеликс 10/40;
  • Mobil Delvac;
  • Nissan 10W40;
  • Magnum 10W40;
  • Mannol.

Какое масло лучше заливать в автоматическую коробку (акпп) Газель Камминз?

Дизельный двигатель Cummins известен благодаря своему универсальному применению, но какое масло лучше заливать в автоматическую коробку (акпп) Газель Камминз? От того, в каком состоянии находится коробка передач авто, зависит не только его экономичность, но и надежность зацепления двигателя и трансмиссии. Масло в кп рекомендуется менять через каждые 60 000 километров пробега. При этом необходимо регулярно проверять уровень трансмиссионной жидкости (через каждые 20 000 километров пробега). В коробку передач заливается 1,2 литра масла. Рекомендуется использовать масло SAE 75W-85 или 75W-90.

Какое масло заливают в механику на заводе (официалы) зимой для Газель Бизнес?

Автовладельцу, который заботится о техническом состоянии своего транспортного средства, необходимо знать, какое масло заливают в механику на заводе (официалы) зимой для Газель Бизнес? Для механической коробки передач Газель Бизнес подходит масло с вязкостью 75W90, 80W90 либо 75w-140. Это может быть трансмиссионная жидкость Liqui Moly GL5 75w90, castrol syntrax longlife 75w-140, ipoid 80W90, TNK 75W90 или Shell.

Замену масла рекомендуют проводить через каждые 50-60 000 километров пробега. Для ее осуществления потребуется около двух литров жидкости.

motoenc.ru

Как отличить подделку от оригинала

Популярные комплектующие для автопрома в последнее время стали часто подделываться, что увеличило риск приобрести контрафактную деталь на авторынке. Чтобы обезопасить себя от покупки низкосортной детали рекомендуется обращать внимание на:

  • Состояние товарной упаковке – деталь и упаковочная тара не должны иметь следов каких-либо повреждений;
  • Наличие сопроводительной документации – большинство производителей кладут в коробку к запчастям или наносят на товарную упаковку сертификату соответствия качеству, а также параметры ГОСТ и ТУ по которым они производились;
  • Серийные данные – штрих код, серийный номер или номер партии производства должны быть читаемые, при пробитии данных в официальном сайте производителя информация должна корректно отображаться.

Это интересно! Хорошим признаком будет наличие в коробке с фильтром набора с уплотнительными резинками – большинство производителей контрафакта в целях экономии не кладут дополнительные аксессуары.

Замена масла Газель Некст cummins своими руками.

Самостоятельная замена масла на автомобиле Газель Некст с двигателем Cummins.

Добрый день, на данном автомобиле устанавливается дизельный Cummins, рекомендуемый срок замены масла 7 — 10 тысяч километров. Замену масла сможет провести почти каждый автолюбитель своими руками.

1. Для начала нужно снять защиту картера, если такая имеется.2. Открываем крышку заливной горловины.3. Нужно залезть под машину, справа снизу, рядом с радиатором и поддоном картера находится масляный фильтр. Для того, что бы его открутить понадобится вороток с удлинителем 1\2. Фильтр, так же можно попробовать открутить руками или за встроенный в корпус квадрат.

4. Сливная пробка находится на поддоне картера, и откручивается квадратом удлинителя и воротка 3\4, через отверстие в балке. 5. Сливаем масло в заранее приготовленную тару.

6. Смазываем резиновые кольца на масляном фильтре и прикручиваем его на место. Номер масляного фильтра на Газель Некст с двигателем Cummins — LF17356.7. Закручиваем сливную пробку на место.

8. Заливаем масло, масла заливается в двигатель Cummins 2,8 примерно 5,7 — 5,8 литра.Заводим двигатель, после того, как лампочка давления масла погаснет, глушим его, и проверяем уровень масла. Уровень масла на щупе должен быть между отметкой минимум и максимум.

Содержащиеся на сайте, сведения о ценах, носят исключительно информационный характер. Указанные цены могут отличаться от действительных цен уполномоченных официальных дилеров и других автосалонах, разных городов и регионов Москва СПБ, Астрахань, Барнаул, Волгоград, Воронеж, Екатеринбург, Ижевск, Иркутск, Казань, Калининград, Краснодар, Красноярск, Набережные Челны, Нижний Новгород, Новосибирск, Омск, Оренбург, Пермь, Ростов-на-Дону, Самара, Саратов, Ставрополь, Тольятти, Тула, Тюмень, Ульяновск, Уфа, Челябинск, Ярославль и т. д.

remont-avto.info

Надежное сотрудничество и качество работы

Каталог запчастей на cummins isf 2.8 содержит только товары от известных и проверенных производителей. Со многими из них мы сотрудничаем напрямую, поэтому цены на детали, поэтому мы предоставляем доступные цены на комплектующие. Запчасти поступают в продажу после многочисленных проверок и тестирований. Это помогает исключить нахождение брака в ассортименте. Запчасти имеют гарантию от производителей, что говорит об их надежности и долговечности.

Подобрать любую запчасть помогут наши опытные и квалифицированные специалисты. Они ответят на все интересующие вопросы и подробно разъяснят правила совершения заказа. Заявки обрабатываются быстро, консультанты в ближайшее время принимают поступившие заказы. Доставка осуществляется по всей России.

Замена моторного масла Газель Next Cummins своими руками

Газель Next – это небольшой грузовик для перевозки грузов в городских условиях, который выпускается Горьковским автомобильным заводом с 2013 года. Предшественником данного автомобиля была Газель Бизнес, которая получила множество изменений в новой версии: это и совершенно новый дизайн, и новая, более безопасная конструкция кабины, моторы и многое другое. Газель Next выпускается не только в Нижнем Новгороде, но и в турецком городе Сакарья. Автомобиль может запросто перевозить груз весом от 1500 килограмм. Главными конкурентами на рынке автомобилей в этом классе являются грузовые машины Mercedes-Benz Sprinter, Iveco Daily и Volkswagen Crafter. Газель Next является хорошим и сравнительно недорогим автомобилем для людей, которые только начинают свой бизнес, так как конструкция позволяет обслуживать авто самому, что делает содержание машины дешевле. Но даже обслуживание на сервисах не будет сильно бить по карману.

Для замены моторного масла Газель Next Cummins количество смазки определяется, исходя из объема двигателя.

Периодичность замены масла

Для людей, которые собираются покупать Газель Next, производитель представляет выбору линейку моторов, которые придутся по вкусу как поклонникам бензиновых и дизельных двигателей, так и любителям ездить на газу. Силовые агрегаты, которые устанавливаются на эти автомобили, достаточно надёжны даже при регулярных транспортировках массивных предметов. Но не стоит забывать, что для того чтобы продлить срок эксплуатации этих двигателей или хотя бы не убить их, нужно всегда вовремя проводить техническое обслуживание. Для этого вам необходимо прочитать инструкцию об эксплуатации и регламент проведения технического обслуживания Газель Next. Помимо информации о пробегах, при которых нужно проводить техническое обслуживание, вы сможете найти в этих книгах множество новой и необходимой для вас информации. Процедура замены масла и её особенности не являются исключением.

Каждый мотор для нормальной работы время от времени нуждается в смене моторного масла. У большинства двигателей пробег, при котором нужно проводить эту процедуру, приблизительно одинаковый, но каждый производитель даёт свои рекомендации. Для дизеля ГАЗ рекомендует проводить смену раз в 10000 километров пробега, а для бензиновых агрегатов – раз в 10000 – 15000 километров пробега. Всегда помните, что при смене моторной смазки масляный фильтр также необходимо обязательно менять.

Заправочный объём двигателей Газель Next

Как мы уже говорили ранее, для этого автомобиля на выбор покупателю представлено несколько силовых агрегатов, а именно:

  • дизельный 2,8-литровый Cummins, который соответствует европейскому экологическому стандарту Евро-4;
  • бензиновый 2,7-литровый Evotech, также соответствующий Евро-4;
  • бензиновый мотор с газовой установкой, 2,7-литровый Evotech, который соответствует европейскому экологическому стандарту Евро-5.

Во время проведения процедуры замены масла нужно помнить заправочный объём вашего двигателя. Его вы также можете найти в книжках, которые идут в комплекте с вашим транспортным средством. Для 2,8-литрового мотора Cummins нужно 6,5 литра смазывающего моторного вещества. Для остальных двух двигателей нужно по 4,5 литра масла. Если вы решили проводить техническое обслуживание машины самостоятельно, то регулярно нужно делать ревизии и проверять уровень масла. Сделать это достаточно просто. Проверка уровня масла проводится с помощью щупа. Для нормальной работы требуется, чтобы показатель на щупе был посредине между о и «MIN».

Выбор подходящей смазки

Информация о выборе подходящего масла также есть в инструкции по эксплуатации Газели Next. Для Газели с дизельным двигателем Cummins завод-производитель рекомендует лить Shell Rimula R6 10W-40 или Shell Helix HX7 Diesel 10W-40. А в бензиновые – Shell Helix HX7 5W-40. Данное масло достаточно распространено почти во всех автомобильных магазинах любого города, так что проблем с его выбором и покупкой не будет. Использовать другое масло мы не рекомендуем, потому что в таком случае стопроцентной гарантии защиты двигателя от износа не гарантировано.

Необходимые для смены инструменты

Для проведения процедуры замены масла собственными силами вам будут необходимы следующие материалы и инструменты:

  1. Для начала вам необходимо купить расходные материалы, которые вы будете менять, а именно: новую смазку с учётом нужного литража, новый масляный фильтр и новую прокладку под болт сливного отверстия.
  2. Второе, это инструмент, который понадобится вам для проведения процедуры. Это съёмник для демонтажа старого фильтра, ключи для снятия защиты двигателя и откручивания сливного отверстия.
  3. Также вам понадобится тара, в которую вы будете сливать отработку.
Алгоритм проведения замены моторного масла в двигателе Газели Next своими руками

Для начала прогрейте мотор вашего авто. Это делается, чтобы отработка легко вытекла с поддона и двигателя машины. После этого подставьте под поддон пустую емкость для отработки и открутите сливную пробку. Также открутите заливное отверстие, во избежание образования вакуума в моторе, что уменьшит время слива старого масла. Вначале масло будет бежать достаточно быстро, но потом каплями, пока не сбежит со всех составляющих силового агрегата.

Пока отработка наполняет ёмкость, вы можете снять старый масляный фильтр и установить новый.

Но перед установкой нового фильтра нужно залить в него приблизительно 150 грамм нового масла и только после этого установить на место. После того как силовой агрегат вашего авто полностью освободится от отработки, закрутите сливное отверстие болтом. Далее залейте новое моторное масло и закрутите заливную пробку.

После смены дайте машине поработать около 15 минут, затем на выключенном моторе проверьте уровень. На этом замена масла окончена.

vibormasla.ru

Как уменьшить расход топлива на дизельном двигателе

Со временем на любом автомобиле растет потребление горючего, поскольку многие детали изнашиваются. Топливо с каждым днем дорожает, и далеко не всем остается по карману содержать «прожорливого железного коня». Особенно подорожание дизеля ударяет по бизнесу, связанными с перевозками груза. В такой ситуации можно воспользоваться некоторыми хитростями, которыми пользуются опытные автолюбители.

Сигнализаторы комбинации приборов «ГАЗель Next»

Расшифровка значков комбинации приборов ГАЗель Next.

Расположение сигнализаторов.

1. Сигнализатор (оранжевый) засорения сажевого фильтра.

Информирует водителя о состоянии сажевого фильтра.

2. Сигнализатор (оранжевый) высокой температуры системы выпуска.

Информирует водителя о засоренности сажевого фильтра.

3. Сигнализатор (оранжевый) низкого уровня охлаждающей жидкости.

При загорании сигнализатора необходимо устранить причину утечки охлаждающей жидкости и довести уровень в расширительном бачке системы охлаждения двигателя до нормы.

4. Сигнализатор (красный) критической неисправности двигателя.

Кратковременно загорается при включении приборов (зажигания). При отсутствии неисправностей загорается при включении приборов (зажигания) и непрерывно горит 2-5 секунд, затем гаснет.

При непрерывном горении информирует водителя о наличии критической неисправности (перегрев двигателя, падение давления масла, отказ газ-педали, критическая неисправность электронного блока) при которой необходимо немедленно прекратить движение и остановить двигатель.

5. Сигнализатор (оранжевый) MIL.

Кратковременно загорается при включении приборов (зажигания). Информирует водителя о неисправностях, фиксируемых бортовой диагностической системой, имеющих отношение к выбросам отработавших газов и твердых частиц.

При непрерывном горении сигнализатора необходимо провести диагностику системы управления двигателем на предприятии технического обслуживания.

После устранения неисправности сигнализатор продолжает гореть в течение четырех циклов пуска двигателя, затем гаснет.

6. Сигнализатор (оранжевый) «Внимание» системы управления двигателем.

При исправной системе управления сигнализатор загорается после включения приборов (зажигания) и непрерывно горит в течение 2-5 секунд, затем гаснет. Это указывает на готовность системы к пуску двигателя.

При непрерывном горении информирует водителя о наличии не критической неисправности, при которой водитель может продолжить движение. В этом случае требуется диагностика автомобиля на предприятии технического обслуживания.

7. Сигнализатор (зеленый) включения левых указателей поворота.

8. Сигнализатор (белый) включения дневных ходовых огней.

9. Сигнализатор (красный) аварийно высокой температуры охлаждающей жидкости

.

Кратковременно загорается при включении приборов (зажигания). При непрерывном горении сигнализатора необходимо немедленно остановить двигатель определить и устранить причину перегрева.

10. Сигнализатор (зеленый) включения габаритных огней.

11. Сигнализатор (красный) «STOP».

Загорается одновременно с одним из аварийных сигнализаторов красного цвета. При загорании указанных сигнализаторов дальнейшая эксплуатация автомобиля не допускается до устранения неисправности.

Горение сигнализатора в мигающем режиме и дублирование периодическим звуковым сигналом указывает на требование остановки пассажирами (нажатие кнопки в салоне).

12. Сигнализатор (синий) включения дальнего света фар.

13. Сигнализатор (оранжевый) минимального резерва топлива в баке.

Загорается при положении поплавка уровня топлива в районе 8 литров.

14. Сигнализатор (зеленый) включения ближнего света фар.

15. Сигнализатор (зеленый) включения правых указателей поворота.

16. Сигнализатор (оранжевый) включения блокировки межосевого дифференциала или резервный.

17. Сигнализатор (оранжевый) включения блокировки дифференциала переднего моста или резервный.

18. Сигнализатор (красный) не пристегнутых ремней безопасности или резервный.

19. Сигнализатор (красный) неисправности подушки или ремня безопасности или резервный.

20. Сигнализатор (оранжевый) отключения подушки безопасности пассажира или резервный.

21. Сигнализатор (оранжевый) отключения системы стабилизации курсовой устойчивости или резервный.

22. Сигнализатор (красный) неисправности электронного регулятора тормозных сил или резервный.

Загорается при включении приборов (зажигания) и гаснет через несколько секунд.

Непрерывное горение сигнализатора или его загорание в движении указывает на неисправность регулятора тормозных сил.

Автомобиль должен быть проверен на предприятии технического обслуживания. Эксплуатация автомобиля до устранения данной неисправности не допускается.

23. Сигнализатор (оранжевый) неисправности системы стабилизации курсовой устойчивости или резервный.

Загорается при включении приборов (зажигания) и гаснет через несколько секунд.

Непрерывное горение сигнализатора или его загорание в движении указывает на неисправность системы курсовой устойчивости.

Автомобиль должен быть проверен на предприятии технического обслуживания.

24. Сигнализатор (зеленый) включения пониженной передачи или резервный.

25. Сигнализатор (оранжевый) неисправности антиблокировочной системы тормозов или резервный.

Загорается при включении приборов (зажигания) и гаснет через несколько секунд.

Длительное горение сигнализатора или его загорание в движении указывает на неисправность антиблокировочной системы тормозов. При этом рабочая тормозная система сохраняет работоспособность.

Автомобиль должен быть проверен на предприятии технического обслуживания.

26. Сигнализатор (красный) незакрытых дверей и/или выдвинутой подножки.

Горение сигнализатора в мигающем режиме и дублирование периодическим звуковым сигналом при движении указывает на незакрытые передние и/или боковые двери и/или выдвинутую подножку.

Горение сигнализатора в постоянном режиме и дублирование постоянным звуковым сигналом указывает на незакрытые задние двери автобуса.

27. Сигнализатор (оранжевый) включения блокировки дифференциала заднего моста или резервный.

28. Сигнализатор (оранжевый) включения подогревателя воздуха (для дизельного двигателя).

Загорается при включении приборов. Пускать двигатель стартером только после того как сигнализатор погаснет.

29. Сигнализатор (оранжевый) наличия воды в топливе (для дизельного двигателя).

Кратковременно загорается при включении приборов.

Непрерывное горение сигнализатора указывает на наличие воды в топливном фильтре. Необходимо немедленно остановить двигатель, слить воду из топливного фильтра или обратиться на предприятие технического обслуживания.

30. Сигнализатор (красный) разряда аккумуляторной батареи.

Загорается при включении приборов (зажигания) и гаснет после пуска двигателя.

Загорание сигнализатора при работающем двигателе указывает на слабое натяжение или обрыв ремня привода навесных агрегатов двигателя или на неисправность в цепи заряда батареи.

31. Сигнализатор (красный) включения стояночного тормоза.

Загорается мигающим светом при включении приборов (зажигания), если автомобиль заторможен стояночным тормозом (дублируется кратковременным звуковым сигналом при движении автомобиля).

32. Сигнализатор (красный) аварийно низкого давления масла.

Загорается при включении приборов (зажигания) и гаснет после пуска двигателя (дублируется кратковременным звуковым сигналом при движении автомобиля).

Загорание сигнализатора при работающем двигателе указывает на низкое давление масла в системе смазки двигателя, при этом необходимо немедленно остановить двигатель и проверить уровень масла в картере, при необходимости, долить. Если уровень масла в пределах нормы, следует обратиться на предприятие технического обслуживания.

33. Сигнализатор (красный) аварийно низкого уровня тормозной жидкости в бачке главного цилиндра тормозов.

Загорание сигнализатора свидетельствует о неисправности тормозной системы.

Автомобиль должен быть немедленно проверен на предприятии технического обслуживания.

Эксплуатация автомобиля до устранения данной неисправности не допускается.

34. Сигнализатор (оранжевый) включения заднего противотуманного света.

Внимание!

Запрещается эксплуатация автомобиля с постоянно горящими или мигающими сигнализаторами красного цвета. В случае невозможности устранения неисправности на месте допускается движение автомобиля до предприятия технического обслуживания за исключением случаев загорания сигнализаторов, запрещающих дальнейшую эксплуатацию. При несвоевременном обращении на предприятие технического обслуживания автомобиль может быть снят с гарантийного обслуживания. Время эксплуатации автомобиля с включенными сигнализаторами записывается в память блока управления.

 

 

Поделиться ссылкой:

Похожие статьи

Прошивка Газель Cummins 2.8 Евро-5 / Евро-4 в Москве

Прошивка двигателя ГАЗель

В нашей мастерской, помимо ремонта двигателя, мы выполняем работы по прошивке двигателей ГАЗель Бизнес, ГАЗель Некст (NEXT), ГАЗель Некст-автобус (Ситилайн), Соболь с двигателем Cummins и ЭБУ Motorola.
Прошивка программно отключает клапан ЕГР (EGR), ДМРВ, дроссель (TVA), модуль сажевого фильтра (DPF/FAP).
Уменьшается расход топлива, пропадают провалы при нажатии педали газа.
Возможность увеличения мощности до 150/170л.с.(без ущерба ресурсу двигателя).

Для ГАЗелей (прошивка ГАЗель Некст ЕВРО 5 / прошивка ГАЗель ЕВРО-5) с экологическим классом ЕВРО-5 мы предлагаем следующие виды работ:

  • Прошивка блока управления двигателя (мозгов) — 3000₽ (без отключения геометрии турбины)
  • Прошивка блока управления двигателя (мозгов) — 5000₽ (отключение геометрии турбины)
  • Прошивка + удаление сажевого фильтра (DPF/FAP) — 10000₽
  • Прошивка + удаление сажевого фильтра (DPF/FAP) + переход на турбину ЕВРО-3/4 — от 25000₽

Для двигателей ГАЗель Камминс 2.8 (Cummins ISF 2.8) поколения ЕВРО-5 очень актуален переход с электронной турбины (турбина с электронным управлением актуатором) на механическую турбину (турбина с механическим управлением актуатором). Это обусловлено несколькими факторами. Во-первых, это экономически ВЫГОДНО. Турбина для двигателей ГАЗель Камминс 2,8 (Cummins ISF 2.8) ЕВРО-3 или ЕВРО-4 стоит почти в 5 раз дешевле, чем аналогичная турбина для двигателя класса ЕВРО-5. Во-вторых, упрощается сама конструкция двигателя. Полностью удаляется катализатор и сажевый фильтр, а так же все датчики температуры выпускных газов (сенсоры EGT). Изготавливаем и устанавливаем обычную приемную трубу. Отключаются клапан ЕГР (EGR), ДМРВ, дроссель (TVA).
Мы переоборудуем Вашу ГАЗель Некст ЕВРО-5, прошьем двигатель и установим в обычную турбину. Больше никаких ошибок (чеков) по геометрии крыльчатки, температуре на входе компрессора и т.п. При поломке — турбина в разы дешевле!

Для ГАЗелей с экологическим классом ЕВРО-4 и ЕВРО-3 мы предлагаем следующие виды работ:

  • Прошивка блока управления двигателя (мозгов) — 3000₽
  • Прошивка + установка заглушки ЕГР (EGR) — 5000₽
  • Прошивка + полное удаление ЕГР (EGR) — от 8000₽

Сажевый фильтр Газ газель next | Festima.

Ru

Мы нaxодимся пo aдресу: г. Воpонeж, ул. Летчикa Кoлесниченко, 36a, 2 этaж, oфиc 202 Гpaфик работы: Пн-Пт 09:30-17:00, Cб 11:00-15:00, Bc выходнoй ✓ Oтпpавляeм зaказы пo Росcии! ✓ Официальный дилер AcеLаb (АВTOАС) ———————————————————— UniCаrSсаn UСSI 2000 диагнoстичeский cкaнер для BМW Портативный сканер для aвтoмобилей ВМW. Cовмeстим с ПК, ноутбуками на базе Windоws, а также со смартфонами на Аndrоid и iОS. Подключение через Вluеtооth. UniСаrSсаn UСSI2000 основан на современном мощном процессоре Соrtех-М0. Полностью совместим с большинством приложений ЕLМ327 и чипом ЕLМ327. Адаптер UniСаrSсаn UСSI2000 на 100% совместим с ВimmеrСоdе. Поддерживает работу со всеми автомобилями, включая новейшие 2020 года выпуска. Список поддерживаемых моделей: Программа ВimmеrСоdе работает с марками ВМW и Мini. Список поддерживаемых моделей: Мini: — Соnvеrtiblе R57 2009-2015 — Соnvеrtiblе F57 2016+ — Соuре R58 2011+ — Сlubmаn R55 2007-2014 — Сlubmаn F54 2015+ — Соuntrymаn R60 2010-2017 — Соuntrymаn F60 2018+ — Соореr R56 2008-2014 — Соореr F55, F56 2014+ — Расеmаn R61 2013-2016 — Rоаdstеr R59 2011+ ВМW: — 1 серия Е81, Е82, Е87, Е88 2008-2013 — 1 серия F20, F21 2011-2019 — 1 серия F40 2019+ — 2 серия F22, F23, F87 2013+ — 2 серия F45 2014+ — 2 серия F46 2015+ — 3 серия Е90, Е91, Е92, Е93 2008-2013 — 3 серия F30, F31, F34, F35, F80 2011-2019 — 3 серия G20, G21 2019+ — 4 серия F32, F33, F36, F82, F83 2013+ — 5 серия Е60, Е61 2008-2010 — 5 серия F07, F10, F11, F18 2010-2017 — 5 серия G30, G31, F90 2017+ — 6 серия Е64, Е64 2008-2010 — 6 серия F06, F12, F13 2011-2018 — 6 серия G32 2017+ — 7 серия F01, F02, F03, F04 2008-2015 — 7 серия G11, G12 2015+ — 8 серия G14, G15, G16, F91, F92 2018+ — Х1 Е84 2009-2015 — Х1 F48 2015+ — Х2 F39 2018+ — Х3 F25 2010-2017 — Х3 G01, F97 2017+ — Х4 F26 2014-2018 — Х4 G02, F98 2018+ — Х5 Е70 2008-2013 — Х5 F15, F85 2013-2018 — Х5 G05 2018+ — Х6 Е71, Е72 2008-2014 — Х6 F16, F86 2014+ — Х6 G06 2019+ — Х7 G07 2019+ — Z4 Е89 2009-2016 — Z4 G29 2018+ — i3 I01 2013+ — i8 I12, I15 2013+ Главная особенность прибора UniСаrSсаn — работа с приложениями ВimmеrСоdе и ВimmеrLink, что позволяет проводить полную диагностику автомобилей ВМW, делать кодирование ЭБУ, проверять и управлять исполнительными механизмами. Разница этих программ в том, что ВimmеrLink показывает показания датчиков, позволяет вести логи, включать регенерацию сажевого фильтра и тд, а ВimmеrСоdе — кодирует опции, как Е-Sys, только намного проще. Список программ, работающих с UniСаrSсаn USСI-2000: — МоtоSсаn (Аndrоid) — диагностика и кодирование мотоциклов ВМW начиная с 1998 — ТunеЕсu (Аndrоid) — программирование мотоциклов Тriumрh, Арriliа, КТМ — SсаnМаstеr Litе (Аndrоid) — все легковые автомобили с 2001 года — SсаnМаstеr (Windоws РС) — все легковые автомобили с 2001 года — ВimmеrСоdе (IОS / Аndrоid) — ВМW серии Е, F, I и G — кодирование — ВimmеrLink  — ВМW серии F и G — диагностика, чтение ошибок — ВТооl Ехреrt (Аndrоid) — для диагностики двигателя и сажевого фильтра для автомобилей ВМW — SсаnМyОреl (Аndrоid) — расширенная диагностика автомобилей марки Ореl с использованием К-Linе — SсаnМyОреlСАN (Аndrоid) — расширенная диагностика автомобилей марки Ореl с использованием САN — ОРL DРF Моnitоr Litе (Аndrоid) — диагностика DРF для отдельных моделей Ореl — ОРL DТС Rеаdеr (Аndrоid) — диагностика и чтение ошибок для автомобилей Ореl — FОRSсаn (Аndrоid, Windоws РС) — расширенная диагностика автомобилей Fоrd и Маzdа — АlfаОВD (Аndrоid) — Диагностика и кодирование Аlfа Rоmео, Fiаt, Lаnсiа, Dоdgе, Rаm, Jеер — Fiаt Есu Sсаn (Windоws РС) — диагностика и кодирование Аlfа Rоmео, Fiаt, Lаnсiа, Dоdgе, Rаm, Jеер — VАG DРF (Аndrоid) — диагностика сажевого фильтра (DРF) Vоlkswаgеn, Аudi, Sеаt, Skоdа — FАРLitе Сitrоеn / Реugеоt (Аndrоid) — диагностика двигателя и DРF РSА Сitrоеn, Реugеоt — ТоyоSys Sсаn Frее (Аndrоid) — диагностика автомобилей Тоyоtа — Тоyоtа ЕLМSсаn — (Аndrоid) — диагностика автомобилей Тоyоtа Также полностью совместим с приложением МоtоSсаn для мотоциклов ВМW. Для диагностики некоторых моделей мотоциклов требуется приобрести отдельно круглый переходник ВМW. Поддерживаемые протоколы: — ISО9141-2 — КWР2000 медленная инициация — КWР2000 быстрая инициация — САN 11bit / 250kВ — САN 11bit / 500kВ — САN 29 бит / 250 КБ — САN 29 бит / 500 КБ — КWР-2000 — D-САN — UDS — все диагностические протоколы для мотоциклов ВМW

Автозапчасти

Сажевые фильтры, катализаторы

Каждый автовладелец рано или поздно сталкивается с неисправностью систем, отвечающих за фильтрацию и нейтрализацию выхлопных газов. На бензиновых автомобилях – такая система называется каталитический нейтрализатор (катализатор), на дизельных автомобилях – сажевый фильтр (DPF, FAP).
Обе системы имеют ограниченный ресурс и напрямую зависит от качества топлива, правильного горения смеси (топливная система, воздух), условий эксплуатации авто (при коротких городских поездках срок работы ощутимо сокращается).

  • повышенный расход топлива
  • потеря мощности автомобиля (включается «аварийный режим», не работает турбина, автомобиль не набирает обороты, такой режим позволяет безопасно добраться до станции, без ущерба для двигателя). В некоторых моделях авто работает алгоритм, когда автомобиль даже невозможно запустить пока не будет устранена проблема с сажевым фильтром/катализатором
  • на дизельных автомобилях – повышение уровня масла

Чтобы определить есть ли проблема с катализатором или сажевым фильтром достаточно сделать грамотную компьютерную диагностику. Обычно блок управления двигателем сам сообщает владельцу о проблеме, и прямо указывает на нее, но не редко встречаются случаи, когда сажевый фильтр на столько забит, что автомобиль уже не заводится – при этом блок управления не регистрирует проблему. В таком случае, мы рассматриваем косвенные данные, которые могут указать нам на наличие или отсутствие проблемы.

  • На дизельных и бензиновых автомобилях с турбироваными моторами. При значительной засоренности фильтра – мы получаем пробку в выхлопной системе, соответственно нарушается температурный режим двигателя, перегрев турбины и ее выход из строя как минимум, не редко встречаются случаи с разрушение ее физически.
  • На дизельных автомобилях блок управления часто подает дополнительные порции солярки, чтобы увеличить температуры на выпуске и запустить прожиг сажевого фильтра. Прожиг не запускается, если степень загрязнения уже критичная, а солярка попадает в масло. Это в свою очередь снижает смазочные свойства масла и может привести к тому, что дизель пойдёт в разнос.
  • На бензиновых автомобилях не редко встречаются случаи не просто оплавления катализатора, а его физическое разрушение. В таком случае, появляется вероятность попадания твердых частиц в цилиндры, что сработает как абразив и приведет к задирам в цилиндрах и последующим дорогостоящим ремонтом мотора.
  1. Заменить сажевый фильтр / катализатор на заводской новый. Это достаточно дорогостоящая запчасть, цена колеблется от $500 до $2000. Обратите внимание, что как таковой гарантии на данную запчасть не предоставляют, ввиду того, что срок службы напрямую зависит от исправности всех систем, которые участвуют в работе состава смеси. Поэтому если у Вас выйдет из строя форсунка и выведет из строя катализатор или сажевик через 2 тыс км, ни один производитель не будет рассматривать данный случай как гарантийный.
  2. Установить универсальный катализатор / сажевый фильтр. Стоимость такой запчасти будет на порядок ниже, но гарантийная политика, описанная в предыдущем пункте, аналогична.
  3. Убрать сажевый фильтр / катализатор из системы выпуска. Физически извлечь фильтр из выхлопной системы и отключить на программном уровне контроль катализатора / сажевого фильтра и забыть об этой системе навсегда. Стоимость такой работы в разы ниже, чем установка нового, но позволяет решить эту проблему навсегда.

Из нашего опыта, конечно, предпочитают вариант удаления и отключения системы навсегда.
Наша компания предоставляет услуги удаление катализатора, отключение программно (перепрошивка), удаление сажевого фильтра и его отключение. Также мы можем отключить системы Adblue, SCR, Bluetec, EGR, Swirl и др.


Как производится процедура:
  1. Первичная диагностика – производится, чтобы подтвердить или опровергнуть диагноз с забитым катализатором / сажевым фильтром. Также диагностика помогает нам увидеть наличие или отсутствие других проблем по автомобилю.
  2. Физическая вырезка катализатора / сажевого фильтра.
  3. Перепрошивка блока управления для отключения контроля катализатора / сажевого фильтра.
  4. Повторная диагностика – производится для контроля правильности выполненных работ.

Стоимость работ зависит от степени сложности работы с физическим удалением катализатора и от блока управления двигателя.

Мы удаляем сажевые фильтры (DPD, DPF, DPA, FAP) любых легковых и легких коммерческих автомобилей (Audi, BMW, Mercedes, Seat, VW, Skoda, Opel, Chevrolet, Peugeot, Renault, Nissan, Honda, Volvo, Mazda и др.)

Возможно отключение сажевых фильтров, ЕГР, систем ADBLUE на грузовых автомобилях.

Большой опыт работы в этой сфере позволяет нашей компании гарантировать Вам 100% корректную работу автомобиля после выполненных работ.

Телефон для консультаций 096 71 28 111.

Cummins ISF 2.8 evro 5 газель Next — MHH AUTO

куфорсес
Расположение Не в сети
Младший член Репутация: 13

Благодарности дано: 87
Получено благодарностей: 65 (34 сообщения)

Сообщения: 141 Потоки: 5
Присоединился: апр 2017 г. 1 10.04.2018, 10:41 (Последнее изменение этого сообщения: 13.04.2018, 21:42 PM пользователем kuforses.)

Добрый день, нужна помощь по отключению EGR off. dpfOFF ~ tun.файлы в формате bin и Calterm. (метафайл подобран) Cummins ISF 2.8 evro 5. ГАЗ Газель Next. Кто сможет это исправить, дайте мне знать. ЭБУ cm2220 .esn 76047715


Прикрепленные файлы

HG80003.rar

Благодарности предоставил:

куфорсес
Расположение Не в сети
Младший член Репутация: 13

Благодарности дано: 87
Получено благодарностей: 65 (34 сообщения)

Сообщения: 141 Потоки: 5
Присоединился: апр 2017 г. 2 13.04.2018, 06:02 (Последнее изменение этого сообщения: 13.04.2018, 21:41, автор: kuforses.)

Прежде чем написать мне и назначить цену, убедитесь, что вы можете исправить прошивку.
.Прочитать kess

Благодарности предоставил:

JuanCL
Местоположение Не в сети
Младший член Репутация: 0

Благодарности дано: 36
Получено благодарностей: 18 (5 сообщений)

Сообщения: 21 Потоки: 0
Зарегистрирован: ноя 2020

Hola me podrias comptir elmetafile para BDP CM2220 IFS2.8
GRACIAS

Благодарности предоставил:

JuanCL
Местоположение Не в сети
Младший член Репутация: 0

Благодарности дано: 36
Получено благодарностей: 18 (5 сообщений)

Сообщения: 21 Потоки: 0
Зарегистрирован: ноя 2020

привет, у кого-то будет метафайл ecfg BDP 30. 51.0.13 ISF 2.8 куплен спасибо за вашу помощь

Благодарности предоставил:

Cummins, Inc.- Портал автомобильной промышленности MarkLines

-Компания является мировым лидером в разработке, производстве, продаже и обслуживании дизельных двигателей и двигателей на альтернативном топливе и связанных с ними компонентов и технологий, таких как фильтрация, дополнительная обработка, турбокомпрессоры, топливные системы, системы управления, системы обработки воздуха, автоматизированные трансмиссии, системы производства электроэнергии, аккумуляторы, продукция для производства водорода и топливных элементов.

-Компания разделена на пять бизнес-сегментов:

  • Двигатель: сегмент производит дизельные двигатели и двигатели, работающие на природном газе, для дорожных и внедорожных транспортных средств, включая автобусы и грузовики средней и большой грузоподъемности, легковые автомобили, сельскохозяйственное оборудование, горнодобывающие машины и морские транспортные средства.
  • Power Systems: сегмент производит высокоскоростные двигатели большой мощности для приложений, включая горнодобывающую промышленность, железнодорожный транспорт, оборону и морской транспорт. Этот сегмент также предлагает генераторы для потребительских, коммерческих, промышленных предприятий, центров обработки данных и здравоохранения.
  • Компоненты: Сегмент разделен на пять направлений деятельности: Фильтрация, производящая фильтры, охлаждающие жидкости и химические продукты; Turbo Technologies, производящая турбокомпрессоры и сопутствующие товары; Emission Solutions, которая разрабатывает и производит технологии и решения для доочистки выхлопных газов; Электроника и топливные системы, которая разрабатывает и модернизирует топливные системы, а также разрабатывает электронные модули управления, датчики и жгуты; и «Автоматизированные трансмиссии», которая разрабатывает и поставляет автоматизированные трансмиссии для грузовых автомобилей большой грузоподъемности.
  • Дистрибьюция: Сегмент обеспечивает продажи, услуги и поддержку для всего спектра продуктов Компании.
  • New Power: сегмент разрабатывает, производит, продает и поддерживает электрифицированные энергосистемы, от полностью электрических до гибридных, а также разрабатывает и производит аккумуляторные модули, блоки и системы для коммерческого, промышленного и погрузочно-разгрузочного применения


-Из пяти бизнес-сегментов компании, сегмент двигателей, сегмент компонентов и сегмент новой энергии поставляют продукцию для автомобильной промышленности.

Конкуренты

Сегмент двигателя

Сегмент компонентов

Поставка продукции на Isuzu

— Многочисленные источники в СМИ в США сообщили, что Isuzu Motors Limited (Isuzu) приобретет дизельные двигатели для грузовиков у американского поставщика двигателей Cummins для своих грузовиков средней грузоподъемности, начиная с моделей, проданных в Северной Америке в 2021 году, а затем в Японии и других странах. другие рынки. Сделка станет первым случаем, когда Isuzu будет использовать двигатели сторонних производителей на своих основных моделях грузовиков. Последняя инициатива представляет собой расширение партнерства, сформированного между Isuzu и Cummins в 2019 году, охватывающее существующие дизельные двигатели, и, в свою очередь, может быть расширено еще больше, если Isuzu будет поставлять двигатели Cummins для грузовиков меньшего размера, чем те, которые она сейчас оснащает. (В нескольких СМИ, 27 января 2021 г.)

Продукты

Двигатели
— Дизельные двигатели для пикапов
— Двигатели, работающие на природном газе для тяжелых грузовиков
— Дизельные двигатели для тяжелых грузовиков
— Дизельные двигатели для грузовиков средней грузоподъемности
— Двигатели на природном газе для грузовиков средней грузоподъемности
-Дизельные двигатели для легких коммерческих автомобилей
-Дизельные двигатели для грузовиков и автобусов
-Газовые двигатели для грузовиков и автобусов

Компоненты
-Продукты для фильтрации

  • Воздушные фильтры
  • Фильтр топливный
  • Фильтры смазочные
  • Фильтры гидравлические
  • Фильтры трансмиссионные
  • Водоотделители топливные
  • Охлаждающие жидкости и химикаты
  • Системы управления вентиляцией картера
  • Смазочные материалы

-Топливные системы

  • Системы впрыска высокого давления
  • Насосы Common Rail
  • Системы впрыска с противодавлением
  • Системы блочного впрыска с электронным управлением

-Турбокомпрессоры

  • Турбокомпрессоры с фиксированной геометрией
  • Турбокомпрессоры Wastegate
  • Holset VGT: Турбокомпрессоры с изменяемой геометрией
  • Силовые турбины
  • Турбокомпрессоры двухступенчатые

-Решения по выбросам

  • Системы избирательного каталитического восстановления
  • Трехкомпонентный катализатор на природном газе
  • Поглотитель NOx
  • Системы дозирования углеводородов
  • Системы дозирования мочевины
  • Резервуары и трубопроводы для мочевины
  • Электронные блоки управления
  • Одномодульные высокоэффективные системы доочистки
  • Катализаторы окисления
  • Сажевый фильтр
  • Датчики давления
  • Датчики температуры
  • Датчики NOx
  • Датчики кислорода

-Электронная и топливная системы

  • Электронные блоки управления
  • Модули управления нейтрализацией
  • Химические датчики
  • Датчики уровня
  • Датчики скорости / положения
  • Датчики свойств жидкости
  • Датчики диспергента
  • Датчики расхода
  • Датчики фильтрации
  • Датчики давления
  • Датчики температуры

Crypsis — обзор | Темы ScienceDirect

C.

Трофические механизмы и типы кормов

Большое разнообразие пищи, потребляемой водными насекомыми, и их различные механизмы питания могут быть организованы в функциональную структуру, сочетающую механизмы питания с размером частиц преобладающего используемого корма (Таблица 22-16). Можно провести различие между травоядными животными, определяемыми как употребление в пищу тканей живых сосудистых растений или водорослей; хищничество — поедание живых тканей животных; и детритив, поглощение неживых твердых частиц органического вещества и связанных с ним микроорганизмов (Cummins, 1973; Hutchinson, 1993).Источниками этого органического вещества являются (а) осажденный фитопланктон, (б) бентосные водные макрофиты, (в) прикрепленные микробные сообщества, и (г) наземная древесная и водно-болотная растительность и животный материал, такой как муравьи и другие насекомые, которые падают. , выдувается или смывается водой. Органические вещества любой из этих категорий могут попадать внутрь либо в виде твердых частиц (при глотании, укусе или жевании), либо в растворенном виде (при прокалывании или сосании). Хотя ассоциация водных насекомых с определенным субстратом обычно напрямую связана с питанием этим субстратом или связанной микрофлорой, это не всегда так.Например, насекомое может использовать водных покрытосеменных в качестве источника воздуха или места для размножения или защиты от хищников. Однако взаимоотношения между насекомыми и некоторыми субстратами (например, покрытосеменными) часто бывают узкоспециализированными и даже видоспецифичными (см. Компиляции McGaha, 1952, и особенно Gaevskaia, 1966). Другие группы насекомых, особенно крупные, такие как двукрылые Chironomidae, демонстрируют большое разнообразие в механизмах питания и потребляемых субстратах (Таблица 22-16).Большинство водных насекомых, как правило, неизбирательны в своих пищевых привычках, но очевидно, что численность, биомасса и разнообразие беспозвоночных наиболее высоки среди подводных местообитаний макрофитов (например, Dvořák, 1987).

ТАБЛИЦА 22-16. Общая классификация трофических механизмов и типов пищевых продуктов водных насекомых a

живые хищники живая ткань сосудистых растений) detritivores): разлагающее тонкодисперсное органическое вещество Hemiptera (Gerridae) 9028 альпинисты Caenidae, Leptophlebiidae, Heptageniidae, Baetidae) Dirona Plecoptera 9025 & ggionidae
Общая категория на основе механизма кормления Общий диапазон размеров частиц пищевых продуктов ( мкм ) по механизмам питания Подразделение на основе доминирующего корма Таксоны водных насекомых, содержащие преобладающие экземпляры
Измельчители & gt; 10 3 Trichoptera (Phryganeidae, Leptoceridae)
Lepidoptera
Coleoptera (Chrysomelidae 302 9026 DIsomelidae 90 302 Пережевыватели и переработчики грубых органических веществ Детритофаги (крупные детритоядные животные): разлагающие ткань сосудистых растений Plecoptera (Filipalpia)
Trichopomato30 Trichopomtera Двукрылые (Tipulidae, Chironomidae)
Стрелки по дереву Древесина Трихоптеры
Колеоптеры 10 3 Фильтры или питатели суспензий b Травоядные-детритофаги: живые клетки водорослей, разлагающие мелкодисперсные органические вещества Ephemeroptera (Siphlonuridae)
yiidae, Hydropsychidae, Brachycentridae)
Lepidoptera
Diptera (Simuliidae, Chironomidae, Culicritidae) (отложение частиц или поверхностные частицы Ephemeroptera (Caenidae, Ephemeridae, Leptophlebiidae, Baetidae, Ephmerellidae, Heptageniidae)
Жесткокрылые (Hydrophilidae)
Двукрылые (Chironomidae, Ceratopogonidae) Скреперы двуядные животные: водоросли и связанная с ними прикрепленная микрофлора к живым и неживым субстратам Ephemeroptera (Heptageniidae, Baetidae, Ephemerellidae)
Trichoptera (Glossosomatidaeidae, Golosomatidae 9028 302 Trichoptera (Glossosomatidae) Чешуекрылые
Жесткокрылые (Elmidae, Psephenidae)
Двукрылые (Herironomidae, Tabanidae)
Hemiptera (Corixidae)
Trichoptera4 Хищники & gt; 10 3 Глотатели Плотоядные животные: глотают животных целиком (или их части) Odonata
Plecoptera Plecoptera
Trichoptera (Rhyacophilidae, Polycentropidae, Hydropsychidae)
Жесткокрылые (Dytiscidae, Gyrinnidae)
двукрылые (Chironomidae)
пробойники Плотоядные : клеточные и тканевые жидкости Hemiptera (Belastomatidae, Nepidae, Notonectidae, Naucoridae)
Diptera (Rhagionidae)
9025 & gt; Пирсеры для травоядных Живые сосуды клетки гидрофитов и тканевые жидкости Neuroptera
Trichoptera

Химическая коммуникация, вероятно, обычна среди пресноводных придонных животных (Dodson et al. , 1994). Виды-жертвы используют химические сигналы для изменения своего морфологического развития, стратегий жизненного цикла, питания и поведения избегания хищников. Такие химические сигналы могут использоваться в темноте или в мутной среде, вероятно, на уровне различия видов животными, у которых нет глаз, формирующих изображение.

Классификация функциональных групп питания среди беспозвоночных, как это было сделано в Таблице 22-16 для водных насекомых, описывает морфологические и поведенческие способности этих организмов потреблять доступные пищевые ресурсы (см., В частности, обзоры Cummins, 1973; Anderson и другие., 1978; Андерсон и Седелл, 1979; Уоллес и Мерритт, 1980; Хатчинсон, 1993; Уоллес и Вебстер, 1996). Факультативно кормящиеся беспозвоночные поедают более широкий спектр субстратов (имеют более широкую нишу) и населяют большее разнообразие водотоков и озер, чем более специализированные кормушки (Cummins and Klug, 1979).

Прием пищи имеет мало отношения к скорости ассимиляции. В ручьях и многих неглубоких озерах и водохранилищах большая часть органического вещества, потребляемого бентическими беспозвоночными и другими питающимися животными, находится в форме мертвого органического вещества в виде твердых частиц высших растений.Этот детрит в виде частиц содержит большое количество лигнинов и целлюлозы из структурных тканей растений, находящихся на различных стадиях медленного разложения. Скорость разложения и количество связанной с ним разлагающейся микрофлоры связаны с химическим составом и ограниченной доступностью микробных ферментов, а также общей нерастворимостью структурных органических соединений.

Скорость усвоения может не отличаться в зависимости от калорийности пищевого материала. Например, случайное попадание неорганического осадка мелкодисперсными детритофагами, очевидно, имеет низкую питательную ценность, но покрытие из органических соединений и прикрепленной микрофлоры может иметь значительную ценность.В качестве альтернативы, небольшие неорганические частицы могут способствовать пищеварению посредством механического разрушения съеденных пищевых клеток в кишечнике. Мало что известно о пищеварительной способности или эффективности использования пищи водными насекомыми (см. Обзоры Cummins, 1973; Anderson et al. , 1978; Cummins and Klug, 1979; Benke and Wallace, 1980; Lamberti and Moore, 1984). . Эффективность ассимиляции бентосными потребителями растительных и детритных частиц почти всегда составляет <50%, а в большинстве случаев находится в диапазоне 5–30%.Эффективность ассимиляции для мелкодисперсного детрита и детрита сосудистых растений намного ниже (около 10%), но возрастает до прибл. 30% для водорослей. В содержимом кишечника и фекалиях можно обнаружить большое количество жизнеспособных водорослей и других микроорганизмов, что свидетельствует о неполном пищеварении.

Мертвый растительный материал, попадающий в водные экосистемы, быстро заселяется микробами, и в деградации преобладают водные гифомицеты и другие микроорганизмы (главы 18 и 21). Микробный катализ неперевариваемых растительных веществ в перевариваемые субъединицы микробными ферментами и добавление относительно легко усваиваемой микробной биомассы, несомненно, являются важным связующим звеном между этими неперевариваемыми органическими материалами и биотической утилизацией (Bärlocher, 1985). Различные виды беспозвоночных различаются по своей способности использовать микробную продукцию и свою биомассу.

Большая часть материала, попадающего в организм беспозвоночных, питающихся подстилкой и отложениями, вероятно, неперевариваема и должна разлагаться ферментативной активностью симбиотической микрофлоры и фауны кишечника. Ряд карбогидраз был обнаружен в пищеварительном тракте нескольких видов Trichoptera, плотоядных амфипод Gammarus и двух видов питающихся донными отложениями двукрылых Chironomus (Бьярнов, 1972).Все виды разлагали моно- и дисахариды, а видовые различия были обнаружены только в разложении полисахаридов. Было обнаружено, что целлюлоза разлагается только амфиподами, а активность хитиназы обнаружена только у хищных видов и у одного детритоядного ручейника. Однако большинство водных насекомых обладают низкой ферментативной активностью по отношению к целлюлозе. Эти виды, обладающие пищеварительной целлюлазой, могут жить в самых разных средах обитания, потому что они могут использовать больший набор типов детрита и водорослей, чем организмы, лишенные этой физиологической адаптации. Ряд личинок двукрылых и трихоптеранов обладают высокой протеолитической активностью для эффективного переваривания бактерий и многоклеточных животных (например, Martin et al. , 1981a, b). Несмотря на потребление детрита, содержащего микробы, микробная биомасса обычно составляет <10% от общей массы детрита (см. Таблицу 21-3). Несмотря на относительно высокую эффективность ассимиляции микробов (например, Martin and Kukor, 1984), органический углерод и азот, полученные из этих источников, часто недостаточны (обычно <25%) для поддержки роста и размножения насекомых.Заметные источники должны происходить из самого твердого органического вещества (например, 73–89% приходится на органическое вещество листьев при росте личинок двукрылых Tipula ; Lawson et al. , 1984).

Макробеспозвоночные используют различные режимы питания, чтобы компенсировать различную пищевую достаточность съеденных субстратов (см. Обзоры Anderson and Cummins, 1979; Anderson and Sedell, 1979; Cummins and Klug, 1979). Шредеры и некоторые сборщики питаются преимущественно органическим детритом в виде частиц, колонизированным микроорганизмами, и используют ассоциированные микроорганизмы и частично гидролизованные субстраты.Сборщики, скребки и факультативные измельчители могут увеличить потребление некачественной пищи (например, устойчивых обломочных частей растений), чтобы компенсировать более низкую питательную ценность. Как правило, время удержания в кишечнике увеличивается обратно пропорционально скорости кормления. Скорость кормления и приема пищи обычно ниже, а время задержки в кишечнике увеличивается, так как качество пищи снижается.

Ряд незрелых пресноводных насекомых, которые потребляют относительно устойчивые растительные материалы и твердые частицы органического детрита, могут содержать микробных симбионтов в своих пищеварительных трактах (Cummins and Klug, 1979).Эти животные аналогичны жвачным млекопитающим, которые потребляют пищу с высоким соотношением C: N (> 17) и поглощают через стенки кишечника материалы с более низким соотношением C: N (<17), производимые кишечной микробиотой, которая разлагает полимеры и поставляет незаменимые аминокислоты. .

Водные насекомые-хищники обильно питаются другой донной добычей. Большинство исследований показывают, что очевидная избирательность жертвы, вероятно, больше зависит от уязвимости жертвы к поимке, чем от выбора хищника (Peckarsky, 1984b).Эффективность ассимиляции съеденных животных жертв и бактерий водными насекомыми обычно выше, чем у растений и детритов, но данных мало (Martin and Kukor, 1984). Водные насекомые выработали множество защитных механизмов и тактик побега, с помощью которых можно избежать нападения хищников. Первичные защиты, такие как морфологическая и химическая защита, действуют независимо от присутствия хищника (Edmunds, 1974). Первичная защита среди водных насекомых включает

1.

Проживание в убежищах, снижающих вероятность встречи жертвы с хищниками. Такие убежища могут быть физическими (расщелины или ямы) или временными (например, ограничивающие активность кормления и передвижения из физических убежищ в периоды темноты).

2.

Крипсис — это любая адаптация, которая делает животное менее заметным (например, визуально или химически) для хищников. Морфологические и поведенческие изменения, сходство цвета с местом обитания и аналогичные методы снижают восприимчивость к хищничеству.

3.

Некоторые жертвы содержат химические соединения, которые явно неприятны хищникам и вызывают их избегание.

Вторичная защита включает активное уклонение от хищника после того, как жертва обнаружила присутствие хищника или начало атаки хищника. Добыча может отступить и убежать, убегая при встрече с хищником. Связанные с рассредоточением дрейфующие движения водных насекомых вниз по течению, о которых будет сказано ниже, наиболее активны в ночное время, когда визуальное нападение рыб уменьшается.Симулирование смерти или нападения может отпугнуть хищников.

Несмотря на общее условно-патологическое поведение при кормлении и недостаточную избирательность пищевых продуктов, многие бентосные животные не едят одну и ту же пищу на протяжении всего своего развития. Размер важен как на верхнем конце диапазона, когда целые частицы не могут быть поглощены («ограничение размера зазора»), так и на нижнем конце диапазона, когда размер проглоченных частиц пищи слишком мал, чтобы компенсировать энергию, затраченную на сбор. . Например, хищные донные беспозвоночные часто начинаются как травоядные или детритоядные, но по мере взросления переходят к плотоядным, а диета может меняться в зависимости от сезона, местности и пола (Malmqvist et al., 1991; Гиллер и Сангпрадуб, 1993).

Большая часть твердых частиц органического вещества, попадающего в озера и водотоки из аллохтонных и автохтонных источников, не поедается животными и либо в конечном итоге разлагается до CO 2 микрофлорой, прикрепленной к частицам, либо сохраняется в течение различных периодов времени в отложениях. Однако кормление и измельчение бентических беспозвоночных может ускорить уменьшение размера частиц и увеличение площади поверхности, подверженной воздействию микробиоты, и тем самым стимулировать скорость микробной деградации.

Биомасса водных насекомых относительно постоянна, если они обеспечиваются постоянными и обильными запасами пищи с аналогичной калорийностью и содержанием белка в течение года (Cummins, 1973; Anderson and Cummins, 1979). Скорость оборота биомассы у насекомых контролируется в первую очередь температурой и опосредуется, главным образом, положительной взаимосвязью между температурой, скоростью кормления и дыханием. Соотношение кормления и дыхания к росту относительно постоянное. В целом в ручьях наблюдаются меньшие сезонные колебания температуры, чем в прибрежных районах озер.В основном водные насекомые, живущие в ручьях, кормятся и размножаются осенью и зимой, даже в зонах с умеренным климатом. Эффективность ассимиляции кажется довольно постоянной для широкого диапазона продуктов, потребляемых насекомыми. Существует предположение (Welch, 1968), основанное на ограниченных и изменчивых данных, что эта эффективность 4 несколько выше у плотоядных, чем у травоядных и детритоядных. Однако эффективность роста нетто или ткани у плотоядных 5 , как правило, ниже, чем у травоядных и детритофагов.

Экодизель Проблемы? Остерегайтесь? | Стр. 4

Не мог рискнуть … форсунки ED имеют более высокую интенсивность отказов, чем форсунки Hemi? Сомневаюсь. Если нет, действительно ли вы снизили свой «риск»? Могли бы оставшиеся 90 000 миль гарантии быть более рискованными, чем новая гарантия 60 000 на новый газовый грузовик? Я не думаю, что форсунки являются серьезной проблемой для обоих двигателей. Более вероятно, что WiTech, сканирующий инструмент Mopar, сказал, что датчики показывают, что это проблема здесь, с возможным решением, являющимися новыми инжекторами, и поскольку по гарантии, где Ram оплачивает детали и работу.. Трудно найти опытных и квалифицированных или честных специалистов для бензиновых двигателей, не говоря уже о дизелях. Сертифицированные специалисты по дизельному оборудованию, обученные работе с дизельным двигателем VM Motori, обычно встречаются только в большом проценте дилерских центров по продажам дизельных грузовиков. Правильная диагностика требует больше знаний и навыков, чем замена деталей, чтобы увидеть, решит ли это проблему.

Хотите снизить риск проблем с выбросами на 14-19 ED, инвестируйте 900 долларов в комплект послепродажной настройки двигателя и трансмиссии. Вы получите чистый работающий двигатель, более беспроблемную работу, большую долговечность, мощность, пробег, а также моторный тормоз.Меньше вероятность поломки, но если у вас есть претензия по гарантии, она будет соблюдаться не иначе, если вы не купите какой-либо тип гоночной мелодии с измененными параметрами безопасности, и Ram может показать, что это каким-то образом вызвало проблему.

744 000 на моем 14 Ram Ecodiesel, если он достигнет большой отметки 1 M, я сделаю его запасным грузовиком. Учитывая как новый ED, так и новый Cummins на его замену. Платформа HD и более мощный Cummins дают мне больше возможностей за счет увеличения первоначальных затрат, затрат на техническое обслуживание и топлива при том же доходе.Так что это компромисс, который мне нужно рассмотреть. Конечно, у Ford и GM тоже есть жизнеспособные варианты, поскольку я не слепой к брендам. Но я бы хотел получить новый ED. Я знаю, что мой сын планирует такой весной, поэтому мы увидим, насколько он способен буксировать, чем мой нынешний грузовик.

Интересный факт. Я действительно хочу, чтобы больше людей купили и больше продавцов порекомендовали бы конкретный грузовик и мотор в зависимости от того, как они будут использоваться, чем, скажем, по цвету или комфорту, как это обычно делается сейчас.

Характеристика взаимодействий химически модифицированных терапевтических нуклеиновых кислот с белками плазмы с помощью флуоресцентного поляризационного анализа | Исследование нуклеиновых кислот

Несмотря на важность этих взаимодействий, аналитические методы, которые могут охарактеризовать константы связывания с отдельными белками плазмы надежным и высокопроизводительным способом, труднодоступны. Мы разработали анализ на основе поляризации флуоресценции (FP) и измерили константы связывания для 25 наиболее распространенных белков плазмы человека с фосфоротиоатными (PS) модифицированными антисмысловыми олигонуклеотидами (ASO). Мы оценили влияние последовательности, модификаций сахара и содержания PS на взаимодействия ASO с несколькими широко распространенными белками плазмы человека и определили влияние соли и pH на эти взаимодействия.С помощью эксклюзионной хроматографии было обнаружено, что PS ASO преимущественно связаны с альбумином и гликопротеином, богатым гистидином (HRG) в плазме мышей и человека. Напротив, ASO PS связываются преимущественно с HRG в плазме обезьян из-за более высоких концентраций этого белка у обезьян. Наконец, белки плазмы, способные связывать PS ASO в плазме человека, были подтверждены с помощью аффинной хроматографии и протеомики. Наши результаты указывают на явные различия во вкладе основной цепи PS, состава азотистых оснований и гибкости олигонуклеотидов в связывание с белками.

Несмотря на то, что в последнее время был достигнут значительный прогресс в понимании клеточного поглощения ASO, включая характеристику нескольких рецепторов клеточной поверхности (6-8), остается неясным, какой вклад белков плазмы в тканевое распределение ASO помимо ограничения клубочковой фильтрации и экскреции с мочой (9) .Недавно мы сообщили, что ASO PS демонстрируют двукратное усиление активности у мышей с нокаутом α-2-макроглобулина, предполагая, что взаимодействия со специфическими белками плазмы могут перемещать ASO в непродуктивные клеточные компартменты (10). Более того, взаимодействия PS ASO со специфическими белками плазмы могут модулировать гематологическую токсичность в компартменте плазмы в зависимости от вида (11). На этом фоне может оказаться полезным способ, который позволяет охарактеризовать взаимодействия PS ASO с отдельными белками плазмы различных видов, используемых для доклинической разработки терапевтических средств на основе нуклеиновых кислот.Однако методы характеристики взаимодействий PS ASO с белками плазмы в значительной степени ограничиваются анализами связывания фильтров и эксклюзионной хроматографией, которые не дают информации о взаимодействиях с отдельными белками (12).

Чтобы решить эти проблемы, мы разработали анализ поляризации флуоресценции (FP), чтобы охарактеризовать взаимодействия PS ASO с отдельными белками плазмы. Анализы на основе FP применялись для широкого спектра биоаналитических приложений, включая клинический анализ и анализ пищевых продуктов, а также мониторинг окружающей среды (13).Молекулярные взаимодействия можно измерить по изменениям деполяризации испускаемой флуоресценции при связывании меченого аналита с макромолекулой. Анализы на основе FP также позволяют измерять константы связывания в растворе при равновесии без необходимости иммобилизации на поверхности белков или аналита. В этой рукописи мы сообщаем об анализе FP для измерения констант связывания белков плазмы с PS ASO. Также сообщается об идентификации Alexa Fluor 647 как оптимального флуоресцентного красителя и о влиянии последовательности ASO, химического состава, основной цепи PS и многонитевой связи на эти взаимодействия.Наконец, влияние видов на связывание с белками плазмы и актуальность взаимодействий с отдельными белками было подтверждено с помощью ASO-аффинной хроматографии и протеомики.

(Сан-Диего, Калифорния, США).Альфа-2-макроглобулин и антихимотрипсин были приобретены в MyBiosource (Сан-Диего, Калифорния, США).

Нативный гликопротеин, богатый гистидином (HRG), был очищен из цитратной плазмы мышей Balb / c, крыс Sprague-Dawley, яванских макак и людей (BioIVT, Westbury, NY, USA) с использованием фосфоцеллюлозной колонки, как описано ранее (14). Рекомбинантный мышиный и человеческий HRG был приобретен в Sino Biologicals (Колледжвилл, Пенсильвания, США). Концентрации HRG в плазме определяли для каждого вида с помощью вестерн-блоттинга с использованием стандартов очищенного и / или рекомбинантного белка.Концентрации HRG в плазме ортогонально подтверждали с помощью ELISA (мышь, человек и крыса) и / или ЖХ / МС с использованием стандартов изобарных пептидов (мышь, человек, обезьяна). Пептиды, используемые для количественного определения HRG из плазмы человека и обезьяны, имеют инвентарные номера Peptide Atlas PAp00024649 и PAp00043573 (15), а пептиды плазмы мыши PAp00399103 и PAp00382579. Изобарически меченные пептиды, используемые в анализе ЖХ / МС, были синтезированы в Pierce Biotechnology (Рокфорд, Иллинойс, США).

Эксперименты по поляризации флуоресценции проводили с использованием ASO, меченных ALEXA647, синтезированных в Integrated DNA Technologies (Коралвилл, Айова, США).Измерения проводили в 1 × фосфатно-солевом буфере (PBS), за исключением экспериментов по определению зависимости связывания от соли и pH. Для этих оценок использовали 10 мМ фосфатный буфер с концентрацией хлорида натрия 50–200 мМ и pH 5, 6 или 7. Анализ проводили в 96-луночных планшетах Costar (черные, с плоским дном, без связывания), приобретенных в Корнинге, штат Нью-Йорк, США. Связывание оценивали путем добавления меченных ALEXA647 ASO, чтобы получить концентрацию 2 нМ в каждую лунку, содержащую 100 мкл белка, от субнМ до низкой мМ концентрации.Показания снимали с помощью прибора Tecan (Болдуин Парк, Калифорния, США) InfiniteM1000 Pro (λ ex = 635 нм, λ em = 675 нм). Используя поляризованные фильтры возбуждения и излучения, прибор измеряет флуоресценцию, перпендикулярную плоскости возбуждения («P-канал»), и флуоресценцию, которая параллельна плоскости возбуждения («S-канал»), а затем вычисляет FP в единицах миллиполяризации. (mP) следующим образом: mP = [(S — P * G) / (S + P * G)] * 1000. «G-фактор» измеряется прибором как поправка на любое смещение в сторону P канал (16).Значения поляризации каждого ASO, меченного ALEXA647, в 1 × PBS при концентрации 2 нМ вычитали из каждого измерения. Значения K d рассчитывали с помощью программного обеспечения GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA) с использованием нелинейной регрессии для подбора кривой, предполагающей один сайт связывания.

Эксклюзионную хроматографию выполняли на колонке Zenix C 300 (Sepax, Newark, DE) в PBS с использованием УФ- и β-RAM обнаружения. Радиоактивно меченый ASO был синтезирован путем смешивания 5′-гексиламино-модифицированного ASO, растворенного в 0. 1 М тетраборат натрия, pH 8,5 и реактив Bolton-Hunter I-125 (2 мС i , PerkinElmer, Waltham, MA) растворяют в ДМСО в течение 2 часов. Реакцию гасили 2 М водн. NaOH, конъюгат очищали с использованием колонки Sephadex G-25 NAP и концентрировали до 0,5 мл, подавая поток азота во флакон. ASO инкубировали в обработанной 50% EDTA плазме различных исследованных видов перед анализом SEC в течение не менее 1 часа при комнатной температуре. Мышей с отсутствием HRG были получены от RWTH Aachen (Германия).

Аффинная хроматография и протеомный анализ применялись для идентификации белков плазмы, которые взаимодействуют с ASO путем связывания ASO, конъюгированных с гексиламином, с сефарозой с карбоксильными группами, активированными как сложные эфиры N-гидроксисукцинимида (NHS) (17,18). Переносы с четырьмя различными дизайнами ASO (5–10–5 MOE PS, ДНК PS, 5–10–5 MOE PO / PS и 3–10–3 cEt PS) были упакованы в колонки. Человеческую плазму вводили в колонки и использовали увеличивающееся количество соли 200, 750 мМ и 2 М ацетата аммония для элюирования белков, связанных с ASO-конъюгированным остатком. Белки 750 мМ элюции каждой конструкции ASO анализировали с использованием протеомики дробовика в MS Bioworks (Анн-Арбор, Мичиган, США). Никакие белки не элюировались из колонки с 5–10–5 MOE PO связанными остатками, демонстрируя, что идентифицированные белки были специфичными для использованных конструкций ASO.

Мышей C57BL / 6 дважды в неделю в течение двух недель лечили нецелевым контролем 5–10–5 MOE PS ASO с последовательностью CCTTCCCTGAAGGTTCCTCC или HRG-целевым 5–10–5 MOE PS ASO TTATTCAGAATATTGTCCTC в дозе 50 мг / кг. Через шесть дней после последнего введения мышам вводили однократное введение активного ASO, нацеленного на SRB 3–10–3 cEt ASO TCAGTCATGACTTC или 5–10–5 MOE SRB ASO с последовательностью GCTTCAGTCATGACTTCCTT в дозах от 0.От 5 мг / кг до 100 мг / кг. Через два дня после введения ASO PTEN или SRB-1 животных умерщвляли, и образцы плазмы и печени собирали в соответствии с утвержденными протоколами. Обработка HRG ASO снижает белок HRG по крайней мере на 80%, измеренный с помощью ELISA.

Эксперименты на животных проводились в соответствии с руководящими принципами Американской ассоциации по аккредитации лабораторных животных и были одобрены Комитетом по благополучию животных (руководящие принципы Институционального комитета по уходу и использованию животных лаборатории Колд-Спринг-Харбор).Животных помещали в клетки-микроизоляторы с постоянным 12-часовым циклом свет-темнота с контролируемой температурой и влажностью, и им предоставляли доступ к пище и воде ad libitum . Ткани собирали, взвешивали, мгновенно замораживали жидким азотом и хранили при -60 ° C.

» data-legacy-id=»SEC3-1″> Разработка метода флуоресцентного поляризационного связывания

ASO были флуоресцентно помечены для использования в анализах FP. Чтобы измерить слабые взаимодействия между ASO и белками, вклад флуоресцентного красителя в связывание должен быть минимальным. Поэтому мы измерили константы связывания нескольких коммерчески доступных красителей с человеческим альбумином, IgG и трансферрином (рис. 1A, B). Все красители были измерены в их карбоксилированной форме (рис. 1С). Для Alexa Fluor 647, sCy5 и Alexa Fluor 488 наблюдалось слабое связывание со всеми исследованными белками, в то время как Cy5 имел наиболее плотное связывание. Alexa Fluor 549 и флуоресцеин относительно прочно связываются с альбумином, но с более низким сродством к IgG и трансферрину. Поскольку Alexa Fluor 647 имеет самое слабое связывание в миллимолярном диапазоне с двумя из трех исследованных белков, ASO, используемые в этом исследовании, были помечены этим красителем.Затем мы оценили, дает ли связывание, измеренное напрямую или путем конкуренции, сопоставимые результаты. Константы связывания ( K d ) некоторых репрезентативных полных PS ASO, меченных Alexa Fluor 647, с человеческим сывороточным альбумином в фосфатно-солевом буфере (PBS) определяли при pH 7,4. Константы связывания гэпмера ICAM ASO и PTEN MOE составляли 4,5 и 2 мкМ соответственно (рис. 1D). Почти идентичные результаты с константами ингибирования ( K i ) 6 и 2 мкМ для двух ASO были определены, когда ASO, меченные Alexa Fluor 647, конкурировали с немечеными ASO (рис. 1D).Соответствие значений K d и K i подтвердило минимальный вклад красителя Alexa Fluor-647 в связывание с белками.

Рисунок 1.

Определение оптимального красителя для измерения взаимодействия ASO с белками плазмы. ( A ) Кривые доза-ответ и ( B ) константы связывания семи широко используемых флуоресцентных красителей с человеческим сывороточным альбумином, IgG и трансферрином. ( C ) Структуры флуоресцентных красителей.( D ) Сравнение прямого связывания с конкурентным связыванием ASO, меченных ALEXA 647, с человеческим сывороточным альбумином. Последовательность ASO CTGCTAGCCTCTGGATTTGA. Кривые доза-ответ рассчитывали с использованием программного обеспечения GrapPad Prism 5.

Рисунок 1.

Определение оптимального красителя для измерения взаимодействия ASO с белками плазмы. ( A ) Кривые доза-ответ и ( B ) константы связывания семи широко используемых флуоресцентных красителей с человеческим сывороточным альбумином, IgG и трансферрином.( C ) Структуры флуоресцентных красителей. ( D ) Сравнение прямого связывания с конкурентным связыванием ASO, меченных ALEXA 647, с человеческим сывороточным альбумином. Последовательность ASO CTGCTAGCCTCTGGATTTGA. Кривые доза-ответ рассчитывали с использованием программного обеспечения GrapPad Prism 5.

Мы использовали ASO, нацеленную на мРНК PTEN (21) с различными сахарами и конструкциями остова, чтобы оценить, как структурные изменения в ASO влияют на связывание с альбумином (рис. 2C).Для гэпмеров MOE с полным основанием PS (5–10–5 MOE PS) была определена константа связывания 10,4 мкМ. Полная версия ДНК PTEN ASO (ДНК PS) связывалась в 3 раза сильнее, в то время как связывание полной версии MOE (полная MOE PS) было в 2,5 раза слабее (рис. 2A). Мы также протестировали гэпмерный мотив смешанного остова, где 4 связи PS были заменены на связи PO в крыльях MOE (5–10–5 MOE PO / PS) и наблюдали 8-кратное снижение связывания по сравнению с 5–10–5 МЧС ПС. Даже 20-мерный олигомер PS без азотистых оснований (abasic) связывал альбумин с 3-кратным снижением аффинности по сравнению с 5–10–5 MOE PS ASO.Эти данные подчеркивают важность фосфоротиоатной связи для связывания альбумина и предполагают лишь ограниченный вклад азотистых оснований во взаимодействие.

Рисунок 2.

Влияние дизайна и последовательности ASO на связывание ASO с сывороточным альбумином человека. ( A ) Кривые доза-реакция и константы диссоциации ASO с различным содержанием PS и MOE. ( B ) Кривые доза-реакция и константы диссоциации ASO с различными последовательностями и химическим дизайном.( C ) Структуры химических модификаций ASO, использованные в этом исследовании. Оранжевыми буквами обозначены MOE, черная ДНК, синий cEt, N = PS-модифицированные абазовые олигонуклеотиды, подчеркнутые буквы представляют связь PO, X = краситель Alexa 647.

Рисунок 2.

Влияние дизайна и последовательности ASO на связывание ASO с человеческим сывороточным альбумином. ( A ) Кривые доза-реакция и константы диссоциации ASO с различным содержанием PS и MOE. ( B ) Кривые доза-реакция и константы диссоциации ASO с различными последовательностями и химическим дизайном.( C ) Структуры химических модификаций ASO, использованные в этом исследовании. Оранжевыми буквами обозначены MOE, черная ДНК, синий cEt, N = PS-модифицированные абазовые олигонуклеотиды, подчеркнутые буквы представляют связь PO, X = краситель Alexa 647.

Затем мы оценили влияние последовательности на связывание с альбумином. Для набора PS ASO с разными последовательностями наблюдали сопоставимое связывание (рис. 2B). Последовательность ДНК ICAM первого поколения имела самое прочное связывание, за ней следовала серия гэпмерных ASO MOE и 3–10–3 cEt ASO.Для гэпмеров 5–10–5 MOE (PTEN, SRB, PTB1B, TNF-α и контрольный ASO) наблюдали диапазон констант связывания от 10,4 мкМ для PTEN до 64,2 мкМ для ASO PTB1B, что свидетельствует о небольшом вкладе нуклеотидных оснований. .

Для фибриногена (27), фактора свертывания крови H (28), факторов комплемента C3 и C4 (29) и фибронектина (30) были определены константы связывания в несколько сотен нМ (870, 500, 500, 430 и 540 нМ соответственно). Белки плазмы, такие как антитромбин III (31), трансферрин (32), аполипопротеин AI (33), плазминоген (34), компонент комплемента C1q (35) и IgG (36), связывают PTEN ASO в диапазоне низких мкМ (8). .7, 7,0, 5,3, 2,1, 3,4 и 1,6 мкМ соответственно). β-2-гликопротеин (37), гаптоглобин (38), церулоплазмин (39), α-1-антихимотрипсин (40) и гемопексин (41) показали константы связывания, сравнимые или немного более слабые по сравнению с сывороточным альбумином (57,1, 54,7, 22,6 , 21,3 и 13,9 мкМ соответственно). Группа белков плазмы со слабым или отсутствующим связыванием включает преальбумин (42), α-1 кислый гликопротеин (AGP) (43), аполипопротеин AII (44) и α-1-антитрипсин (45). Аполипопротеин B100 (46) не показал связывания при наивысшей протестированной концентрации 5 мкМ.Диапазон определенных констант связывания от низких нМ до высоких мкМ демонстрирует, что многие факторы влияют на взаимодействия PS ASO с белками плазмы.

Рисунок 3.

Характеристика связывания Alexa 647, меченного 5–10–5 PS MOE ASO (X-CTGCTAGCCTCTGGATTTGA), с 20 наиболее распространенными белками плазмы. Белок, молекулярная масса, iso, -электрическая точка (pI), концентрация в плазме, константа диссоциации ASO и биологическая функция белка.Кривые связывания представлены в информации о добавках (дополнительный рисунок S1).

Рисунок 3.

Характеристика связывания Alexa 647, меченного 5–10–5 PS MOE ASO (X-CTGCTAGCCTCTGGATTTGA), с 20 наиболее распространенными белками плазмы. Белок, молекулярная масса, iso, -электрическая точка (pI), концентрация в плазме, константа диссоциации ASO и биологическая функция белка. Кривые связывания представлены в дополнительной информации (дополнительный рисунок S1)

Порядок ранжирования связывания 4 различных мотивов PTEN ASO с трансферрином, IgG, фибриногеном, A2M и HRG был идентичен таковому, наблюдаемому для связывания с альбумином (рис. 4A). Полный PS ДНК был наиболее плотно связывающимся мотивом, за ним следовали 5–10–5 MOE PS и полный MOE PS. Для всех белков 5–10–5 MOE PO / PS демонстрируют самое слабое связывание в серии. Интересно, что относительные различия связывания для разных мотивов PTEN ASO становятся меньше, когда константы связывания становятся более жесткими. Для альбумина полный PS ДНК связывается в 25 раз сильнее, чем 5–10–5 MOE PO / PS, для трансферрина это соотношение составляет 15, для фибриногена 5 и A2M только 2.

Рисунок 4.

Характеристика влияния дизайна ASO, модели модификации, последовательности и одноцепочечности для выбранных белков плазмы. ( A ) Константы связывания различных конструкций ASO для выбранных белков плазмы человека. ( B ) Кривые связывания, показывающие различия между связыванием одноцепочечных и двухцепочечных 5–10–5 MOE PS ASO для выбора белков плазмы. Комплементарная РНК, используемая для дуплексирования, была либо немодифицированной, либо полностью модифицированной PS.Последовательность ASO 5′-CTGCTAGCCTCTGGATTTGA. Комплемент РНК 5′-UCAAAUCCAGAGGCUAGCAG (немодифицированный) или 5′-UCAAAUCCAGAGGCUAGCAG (модифицированный PS).

Рисунок 4.

Характеризация эффекта дизайна ASO, паттерна модификации, последовательности и одноцепочечности для выбранных белков плазмы. ( A ) Константы связывания различных конструкций ASO для выбранных белков плазмы человека. ( B ) Кривые связывания, показывающие различия между связыванием одноцепочечных и двухцепочечных 5–10–5 MOE PS ASO для выбора белков плазмы.Комплементарная РНК, используемая для дуплексирования, была либо немодифицированной, либо полностью модифицированной PS. Последовательность ASO 5′-CTGCTAGCCTCTGGATTTGA. Комплемент РНК 5′-UCAAAUCCAGAGGCUAGCAG (немодифицированный) или 5′-UCAAAUCCAGAGGCUAGCAG (модифицированный PS).

Как описано выше, альбумин имел в 3 раза более слабую константу связывания с 20-мерным базовым олигомером PS по сравнению с PTEN 5–10–5 MOE PS, что подчеркивает важность фосфортиоатной связи и отсутствие вклада азотистых оснований в связывание с белками. Напротив, связывание базового олигомера упало в 70 раз для трансферрина, в 500 раз для IgG, в 225 раз для фибриногена и в 25 раз для A2M по сравнению с PTEN MOE PS ASO.Эффект был менее выражен для HRG, где связывание упало в 10 раз. Таким образом, азотистые основания вносят гораздо больший вклад в сродство к этим белкам.

Чтобы исследовать влияние гибкости цепи ASO на связывание с белками плазмы, мы измерили связывание 20-мерных тимидиновых или адениновых гомополимерных ДНК-олигонуклеотидов PS (dT20 и dA20) с нашим ключевым набором белков плазмы. Две гомополимерные последовательности можно рассматривать как модель для последовательностей, не обладающих (dT20) или максимальными (dA20) свойствами самонакупления оснований (47).Во всех случаях связывание с dT20 было более плотным по сравнению с dA20. Степень различия связывания была значительной для большинства белков (100-кратная для трансферрина, 75-кратная для IgG), но только 3-кратная для прочного связывания HRG.

Затем мы исследовали, как дуплексные ASO изменяют связывание с ключевыми белками плазмы. Для PTEN ASO, дуплексного с фосфодиэфирной (PO) РНК, все исследованные белки показали значительную потерю аффинности связывания (рис. 4A и B). Интересно, что даже дуплексы PTEN ASO с PS РНК проявляли значительно более низкую аффинность связывания для всех белков, кроме HRG.Это свидетельствует о том, что гибкая структура ASO способствует эффективному связыванию с этими основными белками плазмы.

Значительно меньшее (<3-кратное) влияние pH на константу связывания ASO наблюдалось для IgG, фибриногена, A2M (фиг. 5B) или HRG. График соотношения констант связывания при pH 5 и 6 по сравнению с pH 7 ясно демонстрирует эту разницу (рис. 5C).

Рисунок 5.

Характеристика влияния pH и концентрации соли на взаимодействия PS ASO с белками плазмы. Связывание ASO с ( A ) сывороточным альбумином человека нарушается, в то время как связывание ( B ) A2M минимально зависит от изменений pH. ( C ) Соотношение констант связывания при pH 5 и 6 по сравнению с pH 7 для 6 белков (D) Отношение констант связывания при концентрации буферной соли NaCl 100, 150 и 200 мМ по сравнению со связыванием при концентрации соли NaCl 50 мМ для шести белки.Последовательность и конструкция ASO PS 5–10–5 MOE ASO X-CTGCTAGCCTCTGGATTTGA.

Рисунок 5.

Характеристика влияния pH и концентрации соли на взаимодействия PS ASO с белками плазмы. Связывание ASO с ( A ) сывороточным альбумином человека нарушается, в то время как связывание ( B ) A2M минимально зависит от изменений pH. ( C ) Соотношение констант связывания при pH 5 и 6 по сравнению с pH 7 для 6 белков (D) Отношение констант связывания при концентрации буферной соли NaCl 100, 150 и 200 мМ по сравнению со связыванием при концентрации соли NaCl 50 мМ для шести белки.Последовательность и конструкция ASO PS 5–10–5 MOE ASO X-CTGCTAGCCTCTGGATTTGA.

Подобная тенденция наблюдалась, когда мы исследовали солевую зависимость связывания этих белков с PTEN MOE PS ASO (рис. 5D). Увеличение концентрации хлорида натрия с 50 до 200 мМ в буфере уменьшало связывание альбумина и A2G в 10 раз, в 5 раз для трансферрина и в 2 раза для IgG. На связывание с фибриногеном повлияла лишь незначительная часть соли, и увеличение связывания наблюдалось для HRG при более высоких концентрациях соли.

Сначала мы измерили константы связывания серии ASO PTEN с альбумином человека, мыши, крысы и обезьяны (рис. 6А). Альбумин крысы имел самую жесткую константу связывания 500 нМ для 5–10–5 MOE PS, за которой следовали обезьяны и мыши с константами диссоциации 2.1 и 2,6 мкМ соответственно. Мы определили константу связывания для человеческого сывороточного альбумина 6,6 мкМ, самую низкую аффинность по сравнению с другими видами и сопоставимую с результатом, описанным выше для связывания с альбумином с использованием другого коммерческого источника. Различные мотивы последовательности PTEN продемонстрировали сходное поведение связывания для всех четырех видов с наиболее плотным связыванием, наблюдаемым для полного PS ДНК, за которым следовали 5–10–5 MOE PS, полный MOE и 5–10–5 MOE PO / PS. . Мы также исследовали взаимодействие полных PS ASO с HRG разных видов и обнаружили, что все они связывают PS ASO с одинаково высоким сродством (рис. 6C).

Рисунок 6.

Характеристика взаимодействия ASO с белками плазмы различных видов. ( A ) Влияние дизайна и модификации ASO на связывание с сывороточным альбумином человека, мыши, крысы и обезьяны. ( B ) Связывание MALAT-1 3–10–3 cEt ASO и соответствующего дуплекса РНК PO с плазмой человека, мыши, крысы и обезьяны. ( C ) Константы диссоциации HRG человека, мыши, крысы и обезьяны до MALAT-1 3–10–3 PS и PTEN 5–10–5 MOE PS ASO.Изображено связывание PTEN PS ASO с HRG исследуемых видов. ( D ) Профиль связывания с помощью эксклюзионной хроматографии меченного 125I 5–10–5 MOE PS ASO с плазмой человека, мыши, обезьяны и крысы. 1 указывает на элюаты ASO, связанные с HRG, 2 указывает на элюты ASO, связанные с сывороточным альбумином, и 3 указывает на несвязанный ASO. ( E ) Нокдаун HRG увеличивает эффективность 3–10–3 cEt и 5–10–5 MOE SRB ASO. Нокдаун SRB оценивался после того, как HRG был снижен на 90% с использованием HRG ASO.В отдельной группе использовался нецелевой контроль ASO без нокдауна HRG.

Рисунок 6.

Характеристика взаимодействия ASO с белками плазмы разных видов. ( A ) Влияние дизайна и модификации ASO на связывание с сывороточным альбумином человека, мыши, крысы и обезьяны. ( B ) Связывание MALAT-1 3–10–3 cEt ASO и соответствующего дуплекса РНК PO с плазмой человека, мыши, крысы и обезьяны. ( C ) Константы диссоциации HRG человека, мыши, крысы и обезьяны до MALAT-1 3–10–3 PS и PTEN 5–10–5 MOE PS ASO.Изображено связывание PTEN PS ASO с HRG исследуемых видов. ( D ) Профиль связывания с помощью эксклюзионной хроматографии меченного 125I 5–10–5 MOE PS ASO с плазмой человека, мыши, обезьяны и крысы. 1 указывает на элюаты ASO, связанные с HRG, 2 указывает на элюты ASO, связанные с сывороточным альбумином, и 3 указывает на несвязанный ASO. ( E ) Нокдаун HRG увеличивает эффективность 3–10–3 cEt и 5–10–5 MOE SRB ASO. Нокдаун SRB оценивался после того, как HRG был снижен на 90% с использованием HRG ASO. В отдельной группе использовался нецелевой контроль ASO без нокдауна HRG.

Чтобы определить, относится ли измерение взаимодействий с отдельными белками к взаимодействиям в цельной плазме, мы измерили сродство связывания ASO PS со всей плазмой крысы, мыши, человека и обезьяны (рис. 6B). Мы обнаружили, что измерение взаимодействий с отдельными белками действительно может быть актуальным, поскольку мы наблюдали наиболее тесное связывание с плазмой обезьян, которая имеет более высокие уровни HRG по сравнению с другими видами.Плазма крысы также демонстрирует повышенное связывание, учитывая более высокое сродство крысиного альбумина к PS ASO.

Чтобы определить, можно ли повторно оценить связывание, измеренное отдельными белками, в биологической матрице, была проведена эксклюзионная хроматография (SEC) с 5–10–5 MOE SRB PS ASO, инкубированной в плазме человека, мыши, крысы и обезьяны при температуре Концентрация 5 мкМ. Связывание с отдельными фракциями контролировали, добавляя в родительский ASO небольшую часть 125 I-меченного ASO с той же последовательностью, что и родительский. Профили показывают широкое распределение SRB ASO для многих белков с несколькими видимыми отчетливыми пиками, которые соответствуют связыванию с альбумином, HRG и несвязанным ASO (рис. 6D). Мы подтвердили пик связывания HRG в плазме мышей дикого типа, сравнив профиль с плазмой мыши с нокаутом HRG (48), где не было пика связывания HRG ASO (дополнительная фигура S2).

Относительная высота пика связывания HRG у разных видов коррелирует с уровнем белка у этих видов, самый низкий уровень у человека составляет приблизительно 1 мкМ, за ним следуют крыса и мышь с 3 мкМ и обезьяна с 5 мкМ.Для крыс наблюдалось самое высокое связывание с альбумином, что согласуется с прочным связыванием, измеренным для изолированного белка. Следовательно, наименьший несвязанный пик наблюдался у крыс, за которыми следовали обезьяны, мыши и люди. Подобный порядок ранжирования наблюдали при оценке видовых различий в связывании с плазмой ASO первого поколения с использованием анализа связывания с фильтром. (12) При оценке этих профилей необходимо учитывать, что более слабые белковые взаимодействия ASO диссоциируют во время разделения, что объясняет довольно небольшой пик связывания альбумина.

Релевантность связывания HRG для активности ASO была подтверждена путем подавления HRG у мышей с использованием ASO с последующим введением ASO, нацеленных на мРНК SRB1 (49). Кратковременное снижение HRG у мышей привело к двукратному увеличению активности SRB1-ASO (фиг. 6E), предполагая, что тесное связывание с HRG шунтирует ASO в менее продуктивные тканевые компартменты.

Человеческую плазму пропускали через колонки, и белки элюировали, увеличивая концентрацию ацетата аммония в буфере для элюента. Белки, собранные при элюировании солью ацетата аммония 750 мМ, идентифицировали с помощью протеомики дробовика с относительным количественным определением белка, выполняемым подсчетом пептидов.При использовании 5–10–5 MOE PS ASO в качестве захватывающего лиганда, альбумин был наиболее распространенным белком по количеству пептидов, за ним следовали комплемент C3, фибронектин, комплемент C4, комплемент C5 и фактор комплемента B (рис. 7). Подсчет пептидов можно рассматривать только как полуколичественный показатель для оценки наиболее распространенных белков в анализе из-за систематических ошибок, основанных на размере белка, относительном количестве и пептидной последовательности (50,51).

Рисунок 7.

Список идентифицированных белков плазмы человека, связывающихся с различными конструкциями ASO, и их относительное количество, основанное на подсчете пептидов (показаны только 30 наиболее распространенных белков, полный список приведен в дополнительной информации, дополнительная таблица S1).

Рисунок 7.

Список идентифицированных белков плазмы человека, связывающихся с различными конструкциями ASO, и их относительное количество, основанное на подсчете пептидов (показаны только 30 наиболее распространенных белков, полный список приведен в таблице дополнительной информации, дополнительная таблица S1).

Всего более 200 белков было идентифицировано с помощью солевой элюции, что подтверждает, что ASO PTEN связывают многие белки плазмы (дополнительная таблица S1). Многие из белков, идентифицированных с высоким содержанием пептидов, были классифицированы как белки с сильным связыванием с константами связывания в диапазоне нМ, определенными с помощью анализа связывания FP.Примерами этих белков являются комплемент C3, комплемент C4, фибриноген, фактор комплемента H и A2M. В соответствии с классификацией белков со слабым связыванием трансферрин, гаптоглобин, гемопексин, преальбумин и кислый гликопротеин α-1 не присутствовали среди 30 белков с наибольшим количеством пептидов, как показано на рисунке 7, но все же их можно было идентифицировать при элюции соли. с довольно низким счетом (дополнительная таблица S1). Неудивительно, что HRG был идентифицирован как связывающий белок, но с довольно низким количеством пептидов, учитывая его высокое сродство к ASO, измеренное с помощью FP.Учитывая, что связывание HRG с ASO минимально зависит от соли, это, по-видимому, затрудняет элюирование HRG из ASO, связанного с колонкой. Помимо комплемента C3 и C4, для которых мы определили константы связывания в диапазоне нМ, несколько других белков комплемента (C2, C5 и C8) были идентифицированы с помощью аффинной хроматографии с большим количеством пептидов, что указывает на их значительную аффинность к 5-10-5 MOE. PS ASO.

Очень похожий порядок ранжирования идентифицированных белков был получен при тестировании другой конструкции ASO (ДНК PS, 5–10–5 MOE PO / PS и 3–10–3 cEt PS) в качестве среды для аффинной хроматографии.Альбумин был идентифицирован как белок с наибольшим количеством пептидов, за ним следовали такие же высокоаффинные белки, как описано для 5–10–5 MOE PS ASO. Наиболее очевидным отличием был более высокий ранг для некоторых иммуноглобулинов от однородного дизайна ДНК PS. В остальном различия довольно тонкие, даже для ASO со смешанным скелетом (PO / PS), который показал гораздо более низкую аффинность связывания со многими изолированными белками по сравнению с 5–10–5 MOE PS или 3–10–3 cEt PS ASO .

Понимание природы взаимодействий PS ASO с отдельными белками плазмы и химических свойств ASO, которые модулируют эти взаимодействия, важно для ответа на более широкий вопрос о том, как препараты нуклеиновой кислоты распределяются в тканях и достигают клеточного входа. В этом исследовании мы сообщаем о наших первоначальных характеристиках взаимодействий PS ASO с белками плазмы с использованием анализа на основе FP.

Число PS-связей и одноцепочечный характер ASO оказались наиболее важными детерминантами для взаимодействия с белками с вкладами азотистых оснований для таких белков, как трансферрин и IgG, но не для альбумина.Одноцепочечная PS-ДНК оказалась самым сильным связующим, в то время как 2′-модификации, такие как MOE и cEt, оказали умеренное влияние на дальнейшую модуляцию этих взаимодействий. Конструкции со смешанным остовом (MBB), которые объединяют PS в разрыв ДНК и связи PO в крыльях MOE, показали пониженное связывание для всех оцениваемых белков. Неконъюгированные ASO MBB обладают достаточным связыванием с белками плазмы для облегчения распределения из места инъекции. Однако эти конструкции демонстрируют пониженную активность, поскольку снижение содержания PS снижает сродство к белкам клеточной поверхности, которые облегчают проникновение ASO в клетки (52).Чтобы решить эту проблему, конструкции MBB ASO недавно были оценены как GalNAc-конъюгаты (53), которые усиливают ассоциацию ASO с рецептором на поверхности клетки (ASGR). MBB 5–10–5 MOE GalNAc-ASO, нацеленный на липопротеин A, недавно продемонстрировал в клинике примерно 30-кратное усиление активности и улучшенную переносимость по сравнению с исходным полным PS ASO (54).

Жесткость нуклеиновой кислоты также оказывала влияние, поскольку 20-мерный PS dA демонстрировал 100-кратное снижение аффинности по сравнению с 20-мерным PS dT. Недавно сообщалось, что политимидилатные олигонуклеотиды обладают большей гибкостью цепи из-за уменьшения взаимодействий между нуклеотидными основаниями при укладке внутри цепи (55).Точно так же дуплексы ASO / РНК, которые являются более жесткими с четко определенной спиральной геометрией, показали значительно сниженное связывание с белками, предполагая, что гибкость, придаваемая одноцепочечной нуклеиновой кислотой, облегчает взаимодействия с белками. Интересно, что дуплексы ASO / РНК также показали пониженную аффинность связывания с цельной плазмой по сравнению с одноцепочечными ASO. Эти наблюдения служат объяснением того, почему терапевтические нуклеиновые кислоты, такие как миРНК или даже недавно описанные дуплексы ASO, часто модифицируются с использованием гидрофобных составляющих, таких как холестерин или токоферол, для обеспечения взаимодействия с липопротеинами плазмы для облегчения тканевого распределения и проникновения в клетки (56–5). 59).

Электростатические взаимодействия играют важную роль в связывании с большинством исследованных белков, как показали исследования солевой зависимости. Из более слабых связывающих белков концентрация соли оказывала наибольшее влияние на альбумин, в то время как на связывание IgG соль меньше влияла. Из белков с более прочным связыванием концентрация соли оказывала наиболее выраженное влияние на аффинность A2M, тогда как связывание HRG несколько увеличивалось с увеличением соли. Аналогичный результат наблюдался при исследовании зависимости от pH. Альбумин показал наиболее выраженное увеличение связывания при более низком pH, тогда как IgG было меньше затронуто. HRG почти не изменяет связывание при более низком pH, тогда как A2M и фибриноген показывают умеренное увеличение аффинности. Эти результаты контрастируют с взаимодействиями PS ASO с рецепторами стабилина, где связывание снижается при более низком pH (4). Некоторые профессиональные эндоцитарные рецепторы, такие как стабилины, TfR и ASGR, имеют pH-чувствительное связывание со своими субстратами для облегчения высвобождения груза внутри эндосомных компартментов, что позволяет рециркулировать рецептор обратно на поверхность клетки.Таким образом, pH-зависимость взаимодействий ASO-белок может иметь значение, поскольку ASO-интернализированные в виде комплексов с определенными белками плазмы могут быть захвачены в эндосомных компартментах, где pH ниже, чем в плазме.

PS ASO связываются со многими белками плазмы с широким диапазоном сродства. PS ASO связываются с более многочисленными белками плазмы, такими как альбумин, IgG, трансферрин, аполипопротеин A и комплемент C3, с константами диссоциации от микромолярных до низких. Напротив, PS ASO связываются с некоторыми менее распространенными белками плазмы, такими как HRG, A2M, фактор V и аполипопротеин E с константами связывания 5-50 наномолярных.Напротив, белки, такие как кислый гликопротеин α-1, антитрипсин α-1, преальбумин (TTR), демонстрируют минимальное связывание с PS ASO. В то время как исчерпывающий анализ взаимодействий PS ASO с белками плазмы выходил за рамки настоящего исследования, мы обнаружили, что PS ASO показали двукратное улучшение активности у мышей после нокдауна плазменного HRG. Аналогичным образом, ASO PS также проявляют в 2 раза повышенную активность у мышей с нокаутом A2M (10), что позволяет предположить, что очень тесные взаимодействия с белками плазмы могут препятствовать активности, шунтируя ASO в менее продуктивные пути захвата и / или тканевые компартменты.

Взаимодействия со специфическими белками плазмы могут потенциально модулировать тканевое распределение PS ASO и могут быть приняты в качестве стратегии для повышения активности ASO в тканях за пределами печени. Например, альбумин активно транспортируется через эндотелий капилляров через трансцитоз, опосредованный кавеолином-1 (60), и почти 60% общего альбумина находится в интерстициальном пространстве в таких тканях, как скелетные мышцы, жир и кожа (61). В отличие от печени, где синусоидальные капилляры позволяют макромолекулярным терапевтическим средствам, таким как ASO, выходить из сосудистой сети и проникать в тканевый интерстиций, ткани, такие как мышца, имеют неповрежденный эндотелий и базальную мембрану, которые необходимо пересечь, чтобы получить доступ к интерстиции и клеточной поверхности паренхиматозные клетки ткани.Таким образом, более плотное, но обратимое связывание с белками плазмы, такими как альбумин, может увеличивать поглощение ASO мышцами, облегчая трансцитоз через эндотелий капилляров.

Значительные видоспецифические различия в связывании общего белка плазмы наблюдались с использованием SEC. Наиболее выраженными были различия для HRG, который был четко виден в виде отчетливого пика на хроматограммах и связывается со всеми видами с очень высоким сродством. Этот эффект был, пожалуй, наиболее поразительным для плазмы обезьян, которая имеет самую высокую концентрацию плазменного HRG (5 мкМ) среди оцениваемых видов.Это наблюдение может быть биологически значимым, поскольку ASO PS обычно проявляют пониженную эффективность у обезьян, которые имеют высокую концентрацию HRG в плазме, по сравнению с мышами и человеком (62). Повышенное связывание с белками плазмы обезьяны было дополнительно подтверждено путем измерения аффинности связывания агрегатов ASO PS с плазмой человека, крысы, мыши и обезьяны. Эти наблюдения дают возможное объяснение того, почему ASO PS демонстрируют пониженную активность у обезьян по сравнению с мышью и человеком.

Таким образом, мы продемонстрировали, что PS ASO взаимодействуют со многими различными белками плазмы с широким диапазоном аффинностей связывания.Отчетливые различия в зависимости от pH и соли наряду с явным предпочтением одноцепочечных олигонуклеотидов демонстрируют, что эти взаимодействия регулируются несколькими структурными особенностями ASO. Анализ FP, по-видимому, хорошо подходит для оценки характеристик связывания PS ASO с белками и может способствовать лучшему пониманию этих взаимодействий и их значения для фармакодинамики, фармакокинетики и токсичности терапевтических средств на основе нуклеиновых кислот.

«> БЛАГОДАРНОСТИ

Авторы любезно благодарят Willi Jahnen-Dechent из RWTH Aachen University за предоставление мышей с нокаутом HRG.

«> ССЫЛКИ

1.

Eckstein

F.

Фосфоротиоаты, основные компоненты терапевтических олигонуклеотидов

.

Nucleic Acid Ther.

2014

;

24

:

374

387

,2.

Stein

C.A.

,

Subasinghe

C.

,

Shinozuka

K.

,

Cohen

J.S.

Физико-химические свойства фосфоротиоатных олигодезоксинуклеотидов

.

Nucleic Acids Res.

1988

;

16

:

3209

3221

.3.

Крук

S.T.

,

Wang

S.

,

Vickers

T.A.

,

Shen

W.

,

Liang

X.-h

Клеточный захват и транспорт антисмысловых олигонуклеотидов

.

Nat. Биотех.

2017

;

35

:

230

237

.4.

Gaus

H.

,

Miller

C.M.

,

Сет

P.P.

,

Харрис

E.N.

Структурные детерминанты взаимодействия химически модифицированных нуклеиновых кислот с рецептором клиренса Stabilin-2

.

Биохимия

.

2018

;

57

:

2061

2064

. 5.

Миллер

C.M.

,

Тановиц

М.

,

Доннер

А.Дж.

,

Пракаш

Т.

,

Суэйзи

E.E.

,

Harris

E.№

,

Seth

P.P.

Опосредованное рецептором поглощение фосфоротиоатных антисмысловых олигонуклеотидов в различных типах клеток печени

.

Nucleic Acid Ther.

2018

;

28

:

119

127

,6.

Миллер

C.M.

,

Доннер

А.Дж.

,

Пустой

E.E.

,

Egger

A.W.

,

Келлар

Б.М.

,

Остергард

М.E.

,

Seth

P.P.

,

Харрис

E.N.

Стабилин-1 и Стабилин-2 являются специфическими рецепторами для клеточной интернализации фосфоротиоат-модифицированных антисмысловых олигонуклеотидов (ASO) в печени

.

Nucleic Acids Res.

2016

;

44

:

2782

2794

,7.

Тановиц

М.

,

Hettrick

Л.

,

Ревенко

А.

,

Кинбергер

Г.А.

,

Пракаш

Т.

,

Сет

P.P.

Асиалогликопротеиновый рецептор 1 опосредует продуктивный захват конъюгированных и неконъюгированных фосфоротиоатных антисмысловых олигонуклеотидов, конъюгированных с N-ацетилгалактозамином

.

Nucleic Acids Res.

2017

;

45

:

12388

12400

.8.

Ван

С.

,

Шестигранник

Н.

,

Виккерс

Т.А.

,

Ревенко

А.С.

,

Sun

H.

,

Liang

X.-h

,

Crooke

S.T.

Клеточное поглощение, опосредованное рецептором эпидермального фактора роста, способствует внутриклеточной активности фосфоротиоат-модифицированных антисмысловых олигонуклеотидов

.

Nucleic Acids Res.

2018

;

46

:

3579

3594

.9.

Гири

R.S.

,

Norris

D.

,

Yu

R.

,

Bennett

C. F.

Фармакокинетика, биораспределение и поглощение клетками антисмысловых олигонуклеотидов

.

Adv. Препарат Делив. Ред.

2015

;

87

:

46

51

.10.

Шемеш

C.S.

,

Yu

R.Z.

,

Gaus

H.J.

,

Seth

P.P.

,

Swayze

E.E.

,

Bennett

F.C.

,

Гири

R.S.

,

Генри

S.P.

,

Ван

Y.

Фармакокинетические и фармакодинамические исследования ION-353382, модельного антисмыслового олигонуклеотида: с использованием мышей с двойным нокаутом альфа-2-макроглобулина и муриноглобулина

.

Nucleic Acid Ther.

2016

;

26

:

223

235

.11.

Шен

Л.

,

Энгельгардт

Дж. А.

,

Hung

G.

,

Yee

J.

,

Kikkawa

R.

,

Matson

J.

,

Tayefeh

B.

,

Machemer

T.

,

Giclas

ПК

,

Генри

S. P.

Эффекты повторной активации комплемента, связанные с хроническим лечением яванских макак 2′-O-метоксиэтил-модифицированным антисмысловым олигонуклеотидом

.

Nucleic Acid Ther.

2016

;

26

:

236

249

.12.

Ватанабе

Т.А.

,

Гири

R.S.

,

Левин

А.А.

Связывание с белками плазмы антисмыслового олигонуклеотида, нацеленного на человеческий ICAM-1 (ISIS 2302)

.

Олигонуклеотиды

.

2006

;

16

:

169

180

. 13.

Холл

M.D.

,

Yasgar

A.

,

Peryea

T.

,

Braisted

J.C.

,

Jadhav

A.

,

Simeonov

A.

,

Coussens

N.P.

Анализ поляризации флуоресценции в высокопроизводительном скрининге и поиске лекарств: обзор

.

Методы Прил. Fluoresc.

2016

;

4

:

022001

.14.

Rylatt

D.B.

,

Sia

D. Y.

,

Mundy

J.P.

,

Parish

C.R.

Фактор ингибирования Autorosette: Выделение и свойства белка плазмы человека

.

евро. J. Biochem.

1981

;

119

:

641

646

. 15.

Schwenk

J.M.

,

Omenn

G.S.

,

Sun

Z.

,

Campbell

D.S.

,

Baker

M.S.

,

Общие

C.M.

,

Aebersold

R.

,

Moritz

R.L.

,

Deutsch

E.W.

Черновик протеома плазмы человека от 2017 г .: Построение пептидов плазмы человека на основе масс-спектрометрии и дополнительных анализов

.

J. Proteome Res.

2017

;

16

:

4299

4310

. 16.

Гулко

А.А.

,

Чжао

Q.

,

Гатри

J.W.

,

Zou

H.

,

Le

X.C.

Resch-Genger

U

Стандартизация и обеспечение качества измерений флуоресценции I: Методы

.

2008

;

Берлин, Гейдельберг

:

Springer

.

303

322

. 17.

Bjarnadottir

S.G.

,

Flengsrud

R.

Аффинная хроматография, двумерный электрофорез, адаптированная иммунная деплеция и масс-спектрометрия, используемые для обнаружения гепарин-связывающих белков плазмы свиней и рыб

.

J. Chromatogr. Б Аналит. Technol. Биомед. Life Sci.

2014

;

944

:

107

113

. 18.

Xu

D.

,

Esko

J.D.

Демистификация взаимодействий гепарансульфат-белок

.

Annu. Rev. Biochem.

2014

;

83

:

129

157

,19.

Griffey

R.H.

,

Greig

M.J.

,

Sasmor

H.

,

Cummins

L.L.

,

Manalili

S.L.

,

Gaus

H.J.

Нековалентные комплексы олигонуклеотидов, наблюдаемые с помощью масс-спектрометрии с ионизацией электрораспылением

.

НАТО ASI Ser., Ser. С

.

1998

;

510

:

117

133

.20.

Коричневый

Д.А.

,

Канг

S.H.

,

Грязнов

С.М.

,

DeDionisio

L.

,

Heidenreich

O.

,

Sullivan

S.

,

Xu

X.

,

Nerenberg

M.I.

Влияние фосфоротиоатной модификации олигодезоксинуклеотидов на специфическое связывание белков

.

J. Biol. Chem.

1994

;

269

:

26801

26805

,21.

Батлер

M.

,

McKay

R.A.

,

Popoff

I.J.

,

Gaarde

W.A.

,

Witchell

D.

,

Murray

S.F.

,

Dean

N.M.

,

Bhanot

S.

,

Monia

B.P.

Специфическое ингибирование экспрессии PTEN обращает вспять гипергликемию у мышей с диабетом

.

Диабет

.

2002

;

51

:

1028

1034

. 22.

Да Коста

L.A.

,

Garcia-Bailo

B.

,

Borchers

C.H.

,

Badawi

A.

,

El-Sohemy

A.

Связь между протеомом плазмы и концентрациями альфа-токоферола в плазме у человека

.

J. Nutr. Биохим.

2013

;

24

:

396

400

. 23.

Андерсон

Н.Л.

,

Андерсон

Н.Г.

Протеом плазмы человека: история, характер и диагностические перспективы

.

Мол. Клетка. Протеомика

.

2002

;

1

:

845

867

,24.

Николаес

Г.А.

,

Dahlback

B.

Фактор V и тромботическая болезнь: описание белка, обращенного к янусу

.

Артериосклер. Тромб. Васк. Биол.

2002

;

22

:

530

538

0,25.

Hauser

P.S.

,

Нараянасвами

В.

,

Райан

Р.О.

Аполипопротеин E: от транспорта липидов к нейробиологии

.

Прог. Lipid Res.

2011

;

50

:

62

74

0,26.

Пун

I.K.H.

,

Patel

K.K.

,

Дэвис

D.S.

,

Parish

C.R.

,

Hulett

M.D.

Гликопротеин, богатый гистидином: швейцарский армейский нож плазмы млекопитающих

.

Кровь

.

2011

;

117

:

2093

2101

,27.

Mosesson

M.W.

Структура и функции фибриногена и фибрина

.

J. Thromb. Гемост.

2005

;

3

:

1894

1904

,28.

Parente

R.

,

Clark

S.J.

,

Inforzato

A.

,

Day

A.J.

Фактор комплемента H в защите хозяина и уклонении от иммунитета

.

Cell. Мол. Life Sci.

2017

;

74

:

1605

1624

,29.

Hajishengallis

G.

,

Reis

E.S.

,

Mastellos

D.C.

,

Ricklin

D.

,

Lambris

J.D.

Новые механизмы и функции дополнения

.

Нат Иммунол

.

2017

;

18

:

1288

.30.

Маурер

Л.M.

,

Ma

W.

,

Mosher

D.F.

Динамическая структура фибронектина плазмы

.

Крит. Rev. Biochem. Мол. Биол.

2015

;

51

:

213

227

. 31.

Хантингтон

J.A.

Строение, функции и дисфункция Серпина

.

J. Thromb. Гемост.

2011

;

9

:

26

34

.32.

Мизутани

К.

,

Toyoda

M.

,

Mikami

B.

Рентгеновские структуры трансферринов и родственных белков

.

Biochim. Биофиз. Acta

.

2012

;

1820

:

203

211

0,33.

Gogonea

V.

Структурные представления о липопротеинах высокой плотности: старые модели и новые факты

.

Фронт. Pharmacol.

2015

;

6

:

318

.34.

Закон

R.H.P.

,

Abu-Ssaydeh

D.

,

Whisstock

J.C.

Новое понимание структуры и функции системы плазминоген / плазмин

.

Curr. Opin. Struct. Биол.

2013

;

23

:

836

841

0,35.

Thielens

N.M.

,

Tedesco

F.

,

Bohlson

S.S.

,

Gaboriaud

C.

,

Теннер

A.J.

C1q: свежий взгляд на старую молекулу

.

Мол. Иммунол.

2017

;

89

:

73

83

,36.

Видарссон

G.

,

Dekkers

G.

,

Rispens

T.

Подклассы и аллотипы IgG: от структуры к эффекторным функциям

.

Фронт Иммунол

.

2014

;

5

:

520

.37.

de Groot

P.G.

,

Meijers

J.C.

бета (2) -гликопротеин I: эволюция, структура и функции

.

J. Thromb. Гемост.

2011

;

9

:

1275

1284

0,38.

Andersen

C.B.

,

Torvund-Jensen

M.

,

Nielsen

M.J.

,

de Oliveira

C.L.

,

Hersleth

H.P.

,

Andersen

N.H.

,

Pedersen

J.S.

,

Андерсен

G.R.

,

Moestrup

S.K.

Структура гаптоглобин-гемоглобинового комплекса

.

Природа

.

2012

;

489

:

456

459

0,39.

Bielli

P.

,

Calabrese

L.

Взаимосвязь между структурой и функцией в церулоплазмине: «подрабатывающий» белок

.

Cell. Мол. Life Sci.

2002

;

59

:

1413

1427

.40.

Бейкер

К.

,

Белбин

О.

,

Калшекер

Н.

,

Морган

К.

SERPINA3 (также известный как альфа-1-антихимотрипсин)

.

Фронт. Biosci.

2007

;

12

:

2821

2835

.41.

Толосано

E.

,

Altruda

F.

Гемопексин: структура, функции и регуляция

.

ДНК Cell Biol.

2002

;

21

:

297

306

.42.

Ричардсон

S.J.

Настройка структуры для радикального изменения функции: эволюция транстиретина от 5-гидроксиизуратгидролазы до распределителя трийодтиронина и распределителя тироксина

.

Фронт. Эндокринол.

2015

;

5

:

245

.43.

Schönfeld

D.L.

,

Ravelli

R.B.G.

,

Mueller

U.

,

Skerra

A.

Кристаллическая структура 1,8 Å α1-кислотного гликопротеина (орозомукоида), решенная с помощью УФ-RIP, показывает широкую лекарственную активность липокалина плазмы человека

.

J. Mol. Биол.

2008

;

384

:

393

405

. 44.

Гао

X.

,

Юань

S.

,

Jayaraman

S.

,

Gursky

O.

Роль аполипопротеина A-II в структуре и ремоделировании липопротеинов высокой плотности человека (HDL): конформационный ансамбль белков на HDL

.

Биохимия

.

2012

;

51

:

4633

4641

.45.

Janciauskiene

S.

,

Wrenger

S.

,

Immenschuh

S.

,

Olejnicka

B.

,

Greulich

T.

,

Welte

T.

,

Chorostowska-Wynimko

J.

Многогранное влияние альфа1-антитрипсина на функции нейтрофилов

.

Фронт. Pharmacol.

2018

;

9

:

341

, 46.

Сегрест

Дж. П.

,

Джонс

М.К.

,

De Loof

H.

,

Dashti

N.

Структура аполипопротеина B-100 в липопротеинах низкой плотности

.

J. Lipid Res.

2001

;

42

:

1346

1367

. 47.

Bar-Ziv

R.

,

Libchaber

A.

Влияние последовательности и структуры ДНК на связывание RecA с одноцепочечной ДНК

.

Proc. Natl. Акад. Sci. США

2001

;

98

:

9068

9073

. 48.

Tsuchida-Straeten

N.

,

Ensslen

S.

,

Schafer

C.

,

Woltje

M.

,

Denecke

B.

,

Moser

M.

,

Graber

S.

,

Wakabayashi

S.

,

Koide

T.

,

Jahnen-Dechent

W.

Усиление свертывания крови и фибринолиза у мышей, лишенных гликопротеина, богатого гистидином (HRG)

.

J. Thromb. Гемост.

2005

;

3

:

865

872

.49.

Murray

S.

,

Ittig

D.

,

Koller

E.

,

Berdeja

A.

,

Chappell

A.

,

Prakash

T.P.

,

Norrbom

M.

,

Swayze

E.E.

,

Leumann

C. J.

,

Seth

P.P.

ТрициклоДНК-модифицированные олиго-2′-дезоксирибонуклеотиды снижают мРНК скавенджер-рецептора B1 в тканях печени и внепеченочных тканях — сравнительное исследование длины, конструкции и химического состава олигонуклеотидов

.

Nucleic Acids Res.

2012

;

40

:

6135

6143

.50.

Wu

C.C.

,

MacCoss

M.J.

Shotgun Proteomics: инструменты для анализа сложных биологических систем

.

Curr. Opin. Мол. Ther.

2002

;

4

:

242

250

. 51.

Йейтс

J.R.

,

Русе

C.I.

,

Накорчевский

А.

Протеомика масс-спектрометрией: подходы, достижения и применения

.

Annu. Преподобный Биомед. Англ.

2009

;

11

:

49

79

,52.

Кинбергер

Г.А.

,

Пракаш

Т.

,

Yu

J.

,

Vasquez

G.

,

Low

A.

,

Chappell

A.

,

Schmidt

K.

,

Murray

H.M.

,

Gaus

H.

,

Swayze

E.E.

et al.

Конъюгация моно- и ди-GalNAc сахаров увеличивает эффективность антисмысловых олигонуклеотидов посредством доставки через ASGR в гепатоциты

.

Bioorg. Med. Chem. Lett.

2016

;

26

:

3690

3693

.53.

Пракаш

Т.

,

Yu

J.

,

Migawa

M.T.

,

Кинбергер

Г.A.

,

Wan

W.B.

,

Ostergaard

M.E.

,

Carty

R.L.

,

Vasquez

G.

,

Low

A.

,

Chappell

A.

et al.

Комплексная взаимосвязь структура-активность трехантенарных антисмысловых олигонуклеотидов, конъюгированных с N-ацетилгалактозамин, для направленной доставки в гепатоциты

.

J. Med. Chem.

2016

;

59

:

2718

2733

.54.

Viney

N.J.

,

van Capelleveen

J.C.

,

Geary

R.S.

,

Ся

С.

,

Тами

Я.А.

,

Ю

Р.З.

,

Марковина

S.M.

,

Hughes

S.G.

,

Graham

M.J.

,

Crooke

R.M.

et al.

Антисмысловые олигонуклеотиды, нацеленные на аполипопротеин (а) у людей с повышенным уровнем липопротеинов (а): два рандомизированных двойных слепых плацебо-контролируемых исследования с ранжированием доз

.

Lancet North Am. Эд.

2016

;

388

:

2239

2253

. 55.

Макинтош

Д. Б.

,

Duggan

G.

,

Gouil

Q.

,

Saleh

O.A.

Последовательно-зависимая эластичность и электростатика одноцепочечной ДНК: признаки укладки оснований

.

Biophys. J.

2014

;

106

:

659

666

.56.

Wolfrum

C.

,

Shi

S.

,

Jayaprakash

K.N.

,

Jayaraman

M.

,

Wang

G.

,

Pandey

R.K.

,

Раджив

K.G.

,

Nakayama

T.

,

Charrise

K.

,

Ndungo

E.M.

et al.

Механизмы и оптимизация доставки липофильных миРНК in vivo

.

Nat. Biotechnol.

2007

;

25

:

1149

1157

. 57.

Akinc

A.

,

Querbes

W.

,

De

S.

,

Qin

J.

,

Франк-Каменецкий

M.

,

Jayaprakash

K.N.

,

Jayaraman

M.

,

Rajeev

K.G.

,

Cantley

W.L.

,

Доркин

Дж.R.

et al.

Направленная доставка терапевтических средств РНКи с помощью механизмов, основанных на эндогенных и экзогенных лигандах

.

Мол. Ther.

2010

;

18

:

1357

1364

,58.

Nishina

K.

,

Piao

W.

,

Yoshida-Tanaka

K.

,

Sujino

Y.

,

Nishina

T.

,

Yamamoto

T.

,

Нитта

К.

,

Yoshioka

K.

,

Kuwahara

H.

,

Yasuhara

H.

et al.

Гетеродуплексный олигонуклеотид ДНК / РНК для высокоэффективного сайленсинга генов

.

Nat. Commun.

2015

;

6

:

7969

,59.

Хасслер

М.Р.

,

Туранов

А.А.

,

Alterman

J.F.

,

Haraszti

R.A.

,

Коулз

А.H.

,

Osborn

M.F.

,

Echeverria

D.

,

Nikan

M.

,

Salomon

W.E.

,

Roux

L.

et al.

Сравнение частично и полностью химически модифицированной миРНК при конъюгированной доставке in vivo

.

Nucleic Acids Res.

2018

;

46

:

2185

2196

0,60.

Макинтош

Д.П.

,

Желто-коричневый

X.-Y.

,

Oh

P.

,

Schnitzer

J.E.

Нацеливание на эндотелий и его динамические кавеолы ​​для тканеспецифичного трансцитоза in vivo : путь преодоления клеточных барьеров для доставки лекарств и генов

.

Proc. Natl. Акад. Sci. США

2002

;

99

:

1996

2001

.61.

Ellmerer

M.

,

Schaupp

L.

,

Brunner

G.A.

,

Sendlhofer

G.

,

Wutte

A.

,

Wach

P.

,

Pieber

T.R.

Измерение интерстициального альбумина в скелетных мышцах и жировой ткани человека методом микроперфузии с открытым потоком

.

г. J. Physiol. Эндокринол. Метаб.

2000

;

278

:

E352

F356

0,62.

Hung

G.

,

Xiao

X.

,

Peralta

R.

,

Bhattacharjee

G.

,

Murray

S.

,

Norris

D.

,

Guo

S.

,

Monia

B.P.

Характеристика уменьшения мРНК-мишени посредством гибридизации РНК in situ во множественных системах органов после системной антисмысловой обработки у животных

.

Nucleic Acid Ther.

2013

;

23

:

369

378

.

© Автор (ы) 2018. Опубликовано Oxford University Press от имени Nucleic Acids Research.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно цитируется.

3 Технологии и топливо для легких транспортных средств | Обзор исследовательской программы U.S. DRIVE Partnership: Пятый отчет

Холладей, Дж. 2016. «Магнитокалорийное сжижение водорода». Тихоокеанская северо-западная национальная лаборатория, проект PD131, презентация для Ежегодного обзора заслуг Министерства энергетики США за 2016 г., Вашингтон, округ Колумбия, 8 июня.

Хауэлл, Д. 2016. «Обзор офиса автомобильных технологий DOE / EERE». Презентация Комитету по обзору исследовательской программы Партнерства США DRIVE, Фаза 5, Вашингтон, округ Колумбия, 3 февраля.

Хауэлл, Д., и Р. Элдер. 2012. «Техническая группа по электрохимическому накоплению энергии (EEST)». Презентация Комитету по обзору исследовательской программы Партнерства США DRIVE, Фаза 4, Вашингтон, округ Колумбия, 26 января.

Хауэлл Д. и К. Снайдер. 2016. «Техническая группа по электрохимическому накоплению энергии (EEST)». Презентация Комитету по обзору исследовательской программы Партнерства США DRIVE, Фаза 5, Вашингтон, округ Колумбия, 19 апреля.

IEA (Международное энергетическое агентство).2016. Global EV Outlook 2016: более миллиона электромобилей. https://www.iea.org/publications/freepublications/publication/Global_EV_Outlook_2016.pdf.

Джеймс, Б.Д., и А.Б. Списак. 2012. Оценка затрат на массовое производство прямого H 2 Системы топливных элементов PEM для транспортных средств: обновление 2012 г., редакция 4. https://www1.eere.energy.gov/hydrogenandfuelcells/pdfs/sa_fc_system_cost_analysis_2012.pdf.

Джеймс, B.D., J.M.Мотон, Д.А. ДеСантис и Г. Заур. 2015. «Анализ перспективных производственных путей h3». Стратегический анализ и Национальная лаборатория возобновляемых источников энергии, проект PD102, презентация для Ежегодного обзора заслуг Министерства энергетики США за 2015 год, Вашингтон, округ Колумбия, 11 июня.

Johnson, T. 2016. Обзор автомобильных выбросов. Международный журнал двигателей SAE 9 (2): 1258-1275.

Joost, W.J. 2012. Снижение веса транспортных средств и повышение энергоэффективности в США с помощью интегрированной инженерии вычислительных материалов. JOM 64 (9): 1032-1038.

Joseck, F. 2016. «Программная область системного анализа». Пленарная презентация на Ежегодном обзоре заслуг Министерства энергетики США, Вашингтон, округ Колумбия, 7 июня.

Joseck, F., and L. Verduzco. 2016. «Презентация технической группы по интеграции топливных путей в комитет NRC». Презентация Комитету по обзору исследовательской программы Партнерства США DRIVE, Фаза 5, Вашингтон, округ Колумбия, 19 апреля.

Joseck, F., and J. Ward.2016. «Анализ жизненного цикла путей движения легких транспортных средств США к топливу». Презентация Комитету по обзору исследовательской программы Партнерства США DRIVE, Фаза 5, Детройт, 22 июня.

Кристов, Л., П. Де Мартини и Дж. Тафт. 2016. История двух видений: Проектирование децентрализованной трансактивной электрической системы. IEEE Power and Energy Magazine 14 (3): 63-69. DOI: 10.1109 / MPE.2016.2524964.

Kurtz, J., S. Sprik, C. Ainscough, and G. Saur. 2015 г.«Оценка электромобилей на топливных элементах». Национальная лаборатория возобновляемых источников энергии, проект TV001, презентация на Ежегодном обзоре заслуг Министерства энергетики США за 2015 год, Вашингтон, округ Колумбия, 10 июня.

Lane, J. 2014. Обновленная информация от DuPont о проекте в Неваде — нехватка рабочей силы, новая сделка с продавцом этанола ». Biofuels Digest , 28 октября. Http://www.biofuelsdigest.com/bdigest/2014/10/28/updatefrom-dupont-on-its-nevada-project-labor-shortages-new-ethanol-marketer-deal/ .

Ларссон, Ф., П. Андерссон, Б.-Э. Мелландер. 2014. «Аспекты аккумуляторных батарей при пожарах в электрифицированных транспортных средствах». Стр. 209–220 в Труды Третьей Международной конференции по пожарам в транспортных средствах — FIVE 2014 г., 1-2 октября 2014 г., Берлин, Германия . http://publications.lib.chalmers.se/records/fulltext/204919/local_204919.pdf.

Лей, Дж. 2016. «Уникальная конструкция двигателя без лантаноидов». UQM Technologies, Inc., Презентация к Ежегодному обзору заслуг Министерства энергетики США за 2016 год, Вашингтон, округ Колумбия.C., 7 июня. Http://energy.gov/sites/prod/files/2016/06/f32/edt044_ley_2016_o_web.pdf.

Ludois, D. 2015. «Бесщеточные синхронные двигатели со свободным возбуждением и постоянным магнитом для тяги электромобилей». Университет Висконсин-Мэдисон, проект EDT065, презентация для Ежегодного обзора заслуг Министерства энергетики США за 2016 год, Вашингтон, округ Колумбия, 9 июня. Http://energy.gov/sites/prod/files/2015/06/f24/edt065_ludois_2015_o. pdf.

.

Добавить комментарий

Ваш адрес email не будет опубликован.